Biology How Life Works Volume 1, 2nd Edition By James Morris – Test Bank

$20.00

Description

INSTANT DOWNLOAD COMPLETE TEST BANK WITH ANSWERS

 

Biology How Life Works Volume 1, 2nd Edition By James Morris – Test Bank

 

Sample  Questions

 

  1. The discovery that DNA from killed virulent bacterial can transform live harmless bacteria into virulent forms means that DNA:
  2. A) is double stranded.
  3. B) is transcribed into RNA.
  4. C) codes for proteins.
  5. D) contains information that controls an organism’s traits.

 

 

  1. If the Avery-MacLeod-McCarty transformation experiment was carried out in an RNA world, the transforming activity would be destroyed by:
  2. A)
  3. B)
  4. C)
  5. D)

 

 

  1. Would a double-stranded DNA molecule carry more information than a single-stranded RNA molecule of the same length? Why?

 

 

  1. A “googol” is the term given to the number 10100 (that is, the number 1 followed by 100 zeros). Given a double-stranded DNA molecule of length n base pairs, how big does n have to be to yield more than a googol of possible sequences?

 

 

  1. A “googol” is the term given to the number 10100 (that is, the number 1 followed by 100 zeros). The DNA molecules in the chromosomes in a human sperm or egg contain approximately 3 × 109 (3 billion) base pairs. How many googol’s worth of genetic information could be encoded in human chromosomal DNA molecules?

 

 

  1. Nonvirulent bacteria can still be transformed into virulent bacteria if it is combined with debris from heat-killed virulent bacteria that is first treated with: (Select all that apply.)
  2. A)
  3. B)
  4. C)
  5. D) no enzyme.

 

 

  1. When a mixture of debris from killed virulent bacteria and live nonvirulent bacteria are injected into mice:
  2. A) the mice are killed because the virulent bacteria are revived.
  3. B) the mice survive because none of the living bacteria are virulent.
  4. C) the mice survive for a period of a few weeks and then die from an unrelated illness.
  5. D) half the mice are killed and the other half survive.
  6. E) the mice are killed because the nonvirulent bacteria are transformed into virulent bacteria.

 

 

  1. What is the central dogma?
  2. A) DNA is transcribed into RNA, which is translated into protein.
  3. B) RNA is transcribed into DNA, which is translated into protein.
  4. C) DNA is transcribed into protein, which is translated into RNA.
  5. D) RNA is transcribed into protein, which is translated into DNA.

 

 

  1. What is the order of processes that support the central dogma?
  2. A) DNA replication, translation, protein synthesis
  3. B) DNA replication, transcription, translation
  4. C) Transcription, DNA replication, translation
  5. D) DNA replication, translation, transcription

 

 

  1. Deoxyribonucleic acid is used for: (Select all that apply.)
  2. A) transmission of information.
  3. B) storage of information.
  4. C) biological catalysis.
  5. D) energy storage.
  6. E) cell-to-cell communication.

 

 

  1. A single unit of heredity that contains the information for an individual protein is referred to as a(n) _____.

 

 

  1. The central dogma of molecular biology states that information flows from:
  2. A) DNA directly to protein.
  3. B) protein to RNA to DNA.
  4. C) DNA to RNA to protein.
  5. D) RNA to protein to DNA.
  6. E) RNA to DNA to protein.

 

 

  1. Translation is the process by which:
  2. A) the information in DNA is used to synthesize an exact copy of that DNA.
  3. B) ribosomes synthesize protein from information in an RNA molecule.
  4. C) a section of DNA is used as information to generate an RNA molecule.
  5. D) an RNA molecule is used to repair damage to a related DNA molecule.
  6. E) ribosomes read the information in a DNA molecule and use it to synthesize protein.

 

 

  1. Many mutations are detrimental to organisms that acquire them, but other mutations are beneficial and allow evolution of that species.
  2. A) True
  3. B) False

 

 

  1. The flow of information from DNA to RNA to protein is referred to as the _____ of molecular biology.

 

 

  1. Muscle cells make different proteins than nerve cells because they have different sequences of DNA.
  2. A) True
  3. B) False

 

 

  1. Why did scientists many years ago believe that protein was the storage molecule for genetic information instead of DNA?
  2. A) There are more building blocks for protein than there are for DNA.
  3. B) Proteins have a wider variety of three-dimensional shapes than DNA.
  4. C) Proteins carry out a great range of cellular functions.
  5. D) All of these choices are correct.

 

 

  1. In the experiments conducted by Avery, McCarty, and MacLeod, which one of the following hypothetical results would indicate that protein, not nucleic acid, was Griffith’s transforming principle?
  2. A) None of the extracts from heat-killed cells is able to transform nonvirulent bacteria.
  3. B) All of the extracts from heat-killed cells are able to transform nonvirulent bacteria.
  4. C) Only the extracts from heat-killed cells treated with RNase are unable to transform nonvirulent bacteria.
  5. D) Only the extracts from heat-killed cells treated with DNase are unable to transform nonvirulent bacteria.
  6. E) Only the extracts from heat-killed cells treated with protease are unable to transform nonvirulent bacteria.

 

 

  1. Which of the following statements is TRUE regarding Frederick Griffith’s experiments?
  2. A) He demonstrated that proteins serve as the genetic/hereditary material.
  3. B) He demonstrated that DNA serves as the genetic/hereditary material.
  4. C) He demonstrated that (only) dead virulent bacteria cause pneumonia in mice.
  5. D) His experiments relied on RNase and DNase to identify the genetic/hereditary material.
  6. E) None of the other answer options is correct.

 

 

  1. In prokaryotes, newly synthesized proteins are found in the _____ and DNA are observed in the _____.
  2. A) cytoplasm; nucleus
  3. B) nucleus; cytoplasm
  4. C) nucleus; nucleus also
  5. D) cytoplasm; cytoplasm also
  6. E) nucleus; nucleus also and the cytoplasm

 

 

  1. In eukaryotes, newly synthesized proteins encoded in genes in the nucleus are found in the _____ and DNA are observed in the _____.
  2. A) cytoplasm; nucleus
  3. B) nucleus; cytoplasm
  4. C) nucleus; nucleus also
  5. D) cytoplasm; cytoplasm also
  6. E) nucleus; nucleus also or the cytoplasm

 

 

  1. No exceptions to the central dogma exist. RNA is always transcribed from DNA, and RNA is translated to produce proteins.
  2. A) True
  3. B) False

 

 

  1. If protease treatment in Avery, MacLeod, and McCarty’s experiment prevented the transformation of bacteria, what would have been the conclusion of these researchers?
  2. A) RNA is the genetic/hereditary material.
  3. B) DNA is the genetic/hereditary material.
  4. C) Protein is the genetic/hereditary material.
  5. D) Protein and RNA are the genetic/hereditary materials.
  6. E) Protein and DNA are the genetic/hereditary materials.

 

 

  1. Imagine that you traveled back in time to the early 1940s. You meet a group of scientists, and tell them that DNA is the hereditary material.  Why might the scientists refute your statement?
  2. A) DNA is linear and appears relatively “simple.”
  3. B) DNA does not appear to (directly) carry out many cellular functions.
  4. C) Proteins can have intricate three-dimensional structures.
  5. D) Proteins are integral parts of many cellular processes.
  6. E) All of these choices are correct.

 

 

  1. In order to evaluate gene expression, a researcher needs to determine if a protein is produced from her gene of interest.
  2. A) True
  3. B) False

 

 

  1. Consider Griffith’s experiment: If he observed healthy mice after injecting these animals with dead virulent and live nonvirulent bacteria, what could he have concluded?
  2. A) Genetic information cannot be transferred between mice.
  3. B) Genetic information cannot be transferred between bacteria.
  4. C) Genetic information is transferrable.
  5. D) The RNA of the bacteria used in this experiment was degraded.
  6. E) None of the other answer options is correct.

 

 

  1. When DNA or genetic information is passed between bacteria (and bacteria take up this material from their surrounding environment), this process is referred to as:
  2. A)
  3. B)
  4. C)
  5. D)
  6. E)

 

 

  1. Which of the following CORRECTLY describes the complementary base pairing of adenine in both DNA and RNA?
  2. A) Adenine pairs with thymine in both DNA and RNA.
  3. B) Adenine pairs with uracil in DNA and with thymine in RNA.
  4. C) Adenine pairs with thymine in DNA and with uracil in RNA.
  5. D) Adenine pairs with cytosine in DNA and with guanine in RNA.
  6. E) Adenine pairs with guanine in DNA and with cytosine in RNA.

 

 

  1. Give the CORRECT complementary base pairs found in DNA and in RNA molecules.

 

 

  1. Imagine you have discovered a new species of bacteria. To begin your investigation of this organism, you run an assay on the total nucleotide content of the bacterial DNA. If the cytosine content of DNA from the bacterial cells is 40%, what is the adenine content?
  2. A) 10 %
  3. B) 20%
  4. C) 40%
  5. D) 605
  6. E) It is not possible to calculate this number for prokaryotes.

 

 

  1. Imagine you have discovered a new species of bacteria. To begin your investigation of this organism, you run an assay on the total nucleotide content of the bacterial cells. If 40 percent of the nucleotides in the DNA are cytosine, what percentage of the DNA is made of adenine nucleotides?

 

 

  1. DNA is often described as having a shape like a spiral staircase. Which of the spiral staircases in the photos below is the better analogous representation of a DNA molecule?

 

  1. A) A
  2. B) B

 

 

  1. In the spiral staircase analogy of DNA structure, each railing represents a _____ and each step represents a _____.
  2. A) sugar-phosphate backbone; pair of bases
  3. B) sugar-phosphate backbone; base
  4. C) base; the sugar-phosphate backbone of the DNA molecule

 

 

  1. DNA is often described as having a shape like a spiral staircase. What parts of the DNA molecule are represented by the railings and by the steps?

 

 

  1. Which of the following is TRUE of DNA?
  2. A) Successive nucleotides in a strand are connected by hydrogen bonds.
  3. B) A phosphate group in a nucleotide is attached to the 3 carbon in ribose.
  4. C) A purine always forms a complementary base pair with a pyrimidine.
  5. D) The percentage of the purine A always equals the percentage of the purine G.
  6. E) It is used by ribosomes for translation.

 

 

  1. The complementary base pairing of nucleotides in a DNA molecule is a structural feature that has important implications for DNA’s function. What is the structural relationship between purine and pyrimidine nucleotides?

 

 

  1. A double-stranded DNA molecule contains 4% of the dinucleotide 5′ –AG–3′. What other dinucleotide also has an abundance of 4%?

 

 

  1. A double-stranded DNA molecule contains 2% of the trinucleotide 5′ –ATG–3′. What other trinucleotide also has an abundance of 2%?

 

 

  1. The central dogma of molecular biology refers to:
  2. A) replication only.
  3. B) transcription only.
  4. C) translation only.
  5. D) replication and transcription.
  6. E) transcription and translation.

 

 

  1. In a double-stranded DNA molecule, the strands are said to be antiparallel because:
  2. A) they wind around one another.
  3. B) each purine of one strand pairs with a pyrimidine of another.
  4. C) they form an uneven pair of grooves on the outside of molecule.
  5. D) one strand runs 5′ to 3′ and the other 3′ to 5′.

 

 

  1. DNA is isolated from a virus and found to contain 27% A, 27% T, 23% C and 23% G. The DNA is likely to be:
  2. A) contaminated with RNA.
  3. B)
  4. C) single stranded.
  5. D) double stranded.

 

 

  1. In double-stranded DNA, the amount of A equals that of T and the amount of C equals that of G because:
  2. A) the strands wind around one another.
  3. B) the strands have complementary sequences of bases.
  4. C) pyrimidines always pair with each other, as do purines.
  5. D) one strand runs 5′ to 3′ and the other 3′ to 5′.

 

 

  1. In a DNA strand, successive nucleotides are linked by:
  2. A) hydrogen bonds
  3. B) base stacking
  4. C) 3′-5′ phosphodiester bonds
  5. D) 2′-5′ phosphodiester bonds
  6. E) peptide bonds

 

 

  1. Chromatin is composed of:
  2. A) histones and DNA.
  3. B) histones, DNA and RNA.
  4. C) histones, DNA, and acidic proteins.
  5. D) histones and DNA surrounded by a membrane.

 

 

  1. In double-stranded DNA, the sugar-phosphate backbones are:
  2. A) on the outside, separated by grooves of equal size.
  3. B) on the outside, separated by grooves of unequal size.
  4. C) on the inside, separated by grooves of equal size.
  5. D) on the inside, separated by grooves of unequal size.

 

 

  1. Which one of the following nucleotides hydrogen base pairs with adenine in an RNA molecule?
  2. A) cytosine
  3. B) thymine
  4. C) uracil
  5. D) adenine
  6. E) guanine

 

 

  1. If the first nucleotide after the promoter on the top DNA strand is changed from G to T, what would the resulting nucleotide be on the mRNA?
  2. A) A
  3. B) C
  4. C) T
  5. D) G

 

 

  1. If the first nucleotide after the promoter on the bottom DNA strand in the simulation is changed from C to T, what would the resulting nucleotide be on the mRNA? Test your prediction by making the change and running the simulation.
  2. A) A
  3. B) C
  4. C) T
  5. D) U

 

 

  1. Occasionally, a double-stranded DNA molecule contains a uracil base (U) instead of T. If a U were present in the template strand of DNA, what base do you think would be incorporated into the RNA transcript at that position?
  2. A) U
  3. B) C
  4. C) T
  5. D) A
  6. E) G

 

 

  1. Which one of the following statements about RNA is INCORRECT?
  2. A) The nucleotide at the 5′ end of an RNA molecule is typically a nucleoside triphosphate.
  3. B) RNA is usually found in double-stranded form, just like DNA.
  4. C) RNA molecules are typically shorter than DNA molecules.
  5. D) RNA molecules can form base pairs within a single strand.
  6. E) RNA molecules are capable of evolving their enzymatic activity over time.

 

 

  1. Which one of the following is LEAST likely to be found in a nucleotide?
  2. A) one or more phosphate groups
  3. B) a five-carbon sugar
  4. C) a side chain
  5. D) a nitrogen-containing base
  6. E) All of the choices are equally likely to be found in a nucleotide.

 

 

  1. In a nucleotide, the phosphate is attached to the _____ carbon of the sugar, and the base is attached to the _____ carbon of the sugar.
  2. A) 1′; 5′
  3. B) 2′; 3′
  4. C) 3′; 5′
  5. D) 5′; 1′
  6. E) 5′; 3′

 

 

  1. A five-carbon sugar connected to a purine or pyrimidine ring is MOST accurately referred to as a(n) _____.

 

 

  1. Which of the following statements about DNA is/are CORRECT? (Select all that apply.)
  2. A) DNA typically exists in cells as a double helix.
  3. B) There are 10 base pairs per turn in a helical DNA molecule.
  4. C) Adenine is complementary to cytosine.
  5. D) The strands in DNA wrap around each other in a helix that coils to the right.
  6. E) Successive nucleotides are attached by peptide bonds.

 

 

  1. Which one of the following represents an actual Watson-Crick base pair with the LARGEST number of hydrogen bonds?
  2. A) adenine and cytosine
  3. B) cytosine and guanine
  4. C) thymine and guanine
  5. D) cytosine and thymine
  6. E) adenine and thymine

 

 

  1. Which one of the following activities would LEAST likely be found in a topoisomerase?
  2. A) cutting a phosphodiester linkage
  3. B) inducing or relaxing twists in double-stranded DNA
  4. C) adding nucleotides to the end of a DNA strand
  5. D) reforming phosphodiester linkages
  6. E) Topoisomerases are equally likely to perform all of these functions.

 

 

  1. Which type of protein does DNA wrap around so that it can be packaged in a cell?
  2. A) histones
  3. B) topoisomerase
  4. C) ribosomal proteins
  5. D) DNA polymerase
  6. E) spliceosome proteins

 

 

  1. Why aren’t nucleosides incorporated into DNA?
  2. A) The bases are not fully assembled.
  3. B) The sugar is not in the right form.
  4. C) There are no phosphates to make the phosphodiester bonds.
  5. D) The peptide bonds don’t form.

 

 

  1. Sometimes the sequence of DNA gets mutated and an adenine is paired to a cytosine. Why is this interaction unstable?
  2. A) Because the phosphate groups of the two bases repel each other.
  3. B) Because an ionic bond cannot be formed between the two.
  4. C) Because the chemical groups that form hydrogen bonds are in the wrong positions.
  5. D) Because the charges on the bases repel one another.

 

 

  1. In the DNA of certain bacterial cells, 16% of the nucleotides are adenine. What are the percentages of the other nucleotides in the bacterial DNA?
  2. A) 16% thymidine, 34% guanine, 34% cytosine
  3. B) 34% uracil, 16% guanine, 16% cytosine
  4. C) 34% thymidine, 34% guanine, 16% cytosine
  5. D) 34% thymidine, 16% guanine, 34% cytosine

 

 

  1. In the DNA of certain bacterial cells, 16% of the nucleotides are adenine. What are the percentages of the other nucleotides in the bacterial DNA?

 

 

  1. Imagine that you are an interior architecture/biology double major. While at home during break, one of your friends asks you to design and help build a spiral staircase that is modeled after a DNA molecule. The staircase must have 12 steps, and each step needs to be 6 feet wide. You say, “OK, as long as you provide the materials.” So, your friend asks you for a list of materials needed to build the staircase. Which of the following includes the items necessary to make a staircase that is based on the molecular structure of a DNA molecule?
  2. A) 1 railing and 12 boards (each of which is 6 feet wide)
  3. B) 2 railings and 12 boards (each of which is 6 feet wide)
  4. C) 2 railings and 24 boards (12 that are 2 feet long and 12 that are 4 feet long)
  5. D) 2 railings and 24 boards (each of which is 3 feet long)
  6. E) 1 railing and 24 boards (12 that are 2 feet long and 12 that are 4 feet long)
  7. F) 1 railing and 24 boards (each of which is 3 feet long)

 

 

  1. Imagine that you are an interior architecture/biology double major. While at home during break, one of your friends asks you to design and help build a spiral staircase that is modeled after a DNA molecule. The staircase must have 12 steps and each step needs to be 6 feet wide. You say, “OK, as long as you provide the materials.” Then your friend shows you what you have to work with: a couple of spiral railings and some boards. The trouble is the only boards he has for you to work with are either 2 feet long or 4 feet long. Explain why you are still able to design and build the staircase using the materials he has on hand.

 

 

  1. In the DNA sequence 5’–TGAC–3′, the phosphodiester linkage between the guanine and the adenine connects:
  2. A) the 3′ end of the guanine to the 5′ end of the adenine.
  3. B) the 2′ end of the adenine to the 3′ end of the guanine.
  4. C) the 5′ end of the guanine to the 1′ end of the adenine.
  5. D) the 3′ end of the adenine to the 5′ end of the guanine.
  6. E) the 5′ end of the guanine to the 2′ end of the adenine.

 

 

  1. The strands in a DNA molecule are: (Select all that apply.)
  2. A)
  3. B)
  4. C)
  5. D)
  6. E) covalently bonded to each other.

 

 

  1. If a DNA molecule is visualized as a wood screw from a hardware store, the threads in the screw would be spaced identical distances from each other.
  2. A) True
  3. B) False

 

 

  1. The hydrophobicity of the planar nitrogenous ring structures of a nucleotide, leading to the exclusion of water and stability of DNA, is referred to as:
  2. A) Watson-Crick base pairing.
  3. B)
  4. C) base-stacking interactions.
  5. D)
  6. E)

 

 

  1. An organism’s genomic DNA is analyzed and found to contain 22% thymine. What percentage of that organism’s DNA is guanine?
  2. A) 22%
  3. B) 28%
  4. C) 44%
  5. D) 56%
  6. E) 78%

 

 

  1. The covalent linkage between nucleotides is referred to as a(n) _____ bond.

 

 

  1. DNA wraps around histone and other proteins to form _____.

 

 

  1. Supercoils in DNA are induced or relaxed by enzymes called topoisomerases.
  2. A) True
  3. B) False

 

 

  1. Which one of the following represents a standard Watson-Crick base pair interaction?
  2. A) G-T
  3. B) C-A
  4. C) G-C
  5. D) A-G
  6. E) T-C

 

 

  1. In the sequence AGGCCT, an available phosphate group would be found at the 5′ end of the nucleotide labeled “T.”
  2. A) True
  3. B) False

 

 

  1. Which of the following is NOT a component of a nucleotide?
  2. A) a five-carbon sugar
  3. B) one or more phosphate groups
  4. C) a nitrogen-containing base
  5. D) a carboxyl group
  6. E) All of these choices are correct.

 

 

  1. In a deoxyribonucleotide, what chemical group is found at the 2′ carbon of the sugar component?
  2. A) an oxygen
  3. B) a hydroxyl group
  4. C) one or more phosphate groups
  5. D) an amino group
  6. E) a hydrogen

 

 

  1. In a nucleotide, to which carbon in the sugar is the base attached?
  2. A) 1′
  3. B) 2′
  4. C) 3′
  5. D) 4′
  6. E) 5′

 

 

  1. Nucleic acid or protein sequences that are very similar from one organism to another are called:
  2. A)
  3. B)
  4. C)
  5. D) coding sequences.

 

 

  1. Select the answer option that arranges the following in order from smallest to largest.
  2. A) genome, gene, nucleotide, nucleoside
  3. B) gene, nucleotide, genome, nucleoside
  4. C) nucleoside, nucleotide, gene, genome
  5. D) nucleotide, nucleoside, gene, genome
  6. E) nucleoside, nucleotide, genome, gene

 

 

  1. The strands in a double helix of DNA are:
  2. A)
  3. B)
  4. C) held together via hydrogen bonds.
  5. D) wound around each other with 10 base pairs per turn.
  6. E) All of these choices are correct.

 

 

  1. Which of the following forces contribute to the stability of a DNA double helix?
  2. A) hydrophobic interactions of bases in the same strand
  3. B) hydrogen bonding between bases in opposite strands
  4. C) ionic interactions between the positively charged component of one base and the negatively charged component of the neighboring base
  5. D) hydrophobic interactions of bases in the same strand and hydrogen bonding between bases in opposite strands
  6. E) hydrophobic interactions of bases in the same strand, hydrogen bonding between bases in opposite strands, and ionic interactions between the positively charged component of one base and the negatively charged component of the neighboring base

 

 

  1. An organism’s genome is analyzed and found to contain 18% thymine. What percentage of that organism’s DNA is cytosine?
  2. A) 32%
  3. B) 18%
  4. C) 82%
  5. D) 64%
  6. E) 36%

 

 

  1. A deoxyribose linked to a thymine is referred to as a:
  2. A)
  3. B)
  4. C) purine nucleotide.
  5. D) purine nucleoside.
  6. E) nucleotide or purine nucleotide.

 

 

  1. Scientists can determine the size of DNA fragments through a process known as gel electrophoresis. In this process, DNA is loaded into a gel submerged in a liquid solution through which an electric current is run.  Large DNA molecules move slower and can be observed at the top of the gel, whereas smaller DNA fragments move faster and are seen at the bottom of the gel.  Based on what you know about the properties of DNA, how is the electric current arranged in this process?
  2. A) Since DNA is negatively charged, the negative end is placed at the top of the gel, and the positive end is placed at the bottom of the gel.
  3. B) Since DNA is negatively charged, the positive end is placed at the top of the gel, and the negative end is placed at the bottom of the gel.
  4. C) Since DNA is positively charged, the negative end is placed at the top of the gel, and the positive end is placed at the bottom of the gel.
  5. D) Since DNA is positively charged, the positive end is placed at the top of the gel, and the negative end is placed at the bottom of the gel.
  6. E) Since DNA is uncharged, the placement of the positive end and negative end does not matter.

 

 

  1. Which one of the following CORRECTLY lists the components necessary for eukaryotic transcription?
  2. A) RNA polymerase, general transcription factors, DNA, and RNA nucleotides
  3. B) RNA polymerase, general transcription factors, DNA, and DNA nucleotides
  4. C) ribosomes, general transcription factors, DNA, and DNA nucleotides
  5. D) ribosomes, general transcription factors, DNA, and RNA nucleotides

 

 

  1. List the components required for eukaryotic transcription.

 

 

  1. RNA makes up the genome of many different viruses, and it was probably the first information molecule in evolutionary history. Yet, cells use DNA as the primary molecule for the storage of genetic information. What features of DNA make it a more suitable informational archive than RNA? (Select all that apply.)
  2. A) The –H group on the 2 carbon of deoxyribose is less reactive than the –OH on the same carbon of ribose.
  3. B) Only DNA is capable of binding to proteins.
  4. C) Double-stranded DNA facilitates rapid and accurate replication of the information.
  5. D) DNA has stronger phosphodiester bonds than RNA does.
  6. E) DNA is converted to RNA by a spontaneous hydrolysis reaction.

 

 

  1. What features of DNA make it a more suitable informational archive than RNA?

 

 

  1. A protein-coding primary transcript contains 3 exons that may be alternatively spliced in such a way that the processed messenger RNA may contain any 1, any 2, or all 3 exons. How many alternatively processed transcripts are possible?

 

 

  1. Protein-coding primary transcript exons may be alternatively spliced in such a way that the processed messenger RNA may contain any 1, any 2, any 3, etc., exons, including the possibility of all of them, How many exons would be needed in the primary transcript to allow a total of 31 alternatively spliced forms?

 

 

  1. RNA polymerase complex can do which of the following?
  2. A) allow RNA-DNA hybrids to form
  3. B) release a finished RNA transcript from a DNA template
  4. C) separate DNA strands
  5. D) restore the original DNA strands
  6. E) All of these choices are correct.

 

 

  1. In which of the following cellular processes is RNA involved?
  2. A) transcription
  3. B) translation
  4. C) splicing
  5. D) transcription and translation
  6. E) All of these choices are correct.

 

 

  1. In an RNA world, which of the following processes would NOT take place?
  2. A) transcription
  3. B) translation
  4. C) DNA replication
  5. D) None of the other answer options is correct.

 

 

  1. Transcription is sometimes described as a process in which RNA is “copied” from the template strand of DNA. This statement is potentially misleading because:
  2. A) RNA nucleotides contain ribose and so cannot be an exact copy of DNA.
  3. B) the RNA transcript and the DNA template strand are antiparallel.
  4. C) the RNA transcript has a complementary sequence of bases to the template strand.
  5. D) RNA molecules contain uracil instead of thymine
  6. E) All of these choices are correct.

 

 

  1. A template DNA strand contains the sequence 5′-ATGCTGAC-3′. The corresponding sequence in the RNA transcript is:
  2. A) 5′-TACGACTG-3′.
  3. B) 5′-GTCAGCAT-3′.
  4. C) 5′-UACGACUG-3′.
  5. D) 5′-GUCAGCAU-3′.

 

 

  1. A template DNA strand contains the sequence 3′-ATGCTGAC-5′. The corresponding sequence in the RNA transcript is:
  2. A) 5′-TACGACTG-3′.
  3. B) 5′-GTCAGCAT-3′.
  4. C) 5′-UACGACUG-3′.
  5. D) 5′-GUCAGCAU-3′.

 

 

  1. A template DNA strand contains the sequence 3′-ATGCTGAC-5′. This strand is transcribed:
  2. A) from left to right.
  3. B) from right to left.

 

 

  1. In the process of transcription, the RNA transcript is synthesized:
  2. A) from the 3′ end to the 5′ end.
  3. B) from the 5′ end to the 3′ end.

 

 

  1. A template DNA strand contains 30% A, 20%T, 27% G, and 23% C. The RNA transcript contains:
  2. A) 30% A, 20% T, 27% G, and 23% C.
  3. B) 30% T, 20% A, 27% C, and 23% G.
  4. C) 30% U, 20% A, 27% C, and 23% G.
  5. D) 30% A, 20% U, 27% G, and 23% C.

 

 

  1. Transcription of RNA from DNA in eukaryotes requires:
  2. A) transcription factors.
  3. B) activator proteins.
  4. C) a promoter sequence.
  5. D) RNA polymerase.
  6. E) All of these choices are correct.

 

 

  1. In transcription, each added ribonucleotide comes into the RNA polymerase complex as a:
  2. A)
  3. B) nucleoside monophosphate.
  4. C) nucleoside diphosphate.
  5. D) nucleoside triphosphate.

 

 

  1. In transcription, the energy to attach each successive ribonucleotide to the growing RNA chain comes from:
  2. A) the RNA polymerase itself.
  3. B) cleavage of the high-energy phosphate bonds of the incoming nucleotide.
  4. C) cleavage of the high-energy phosphate bonds of the growing transcript.
  5. D) cleavage of the 2′ hydroxyl group on the ribose of the incoming nucleotide.

 

 

  1. What steps are necessary for eukaryotic transcription to begin? (Select all that apply.)
  2. A) Transcriptional activator proteins bind to enhancers.
  3. B) General transcription factors bind to the promoter.
  4. C) General transcription factors and sigma factor bind to the promoter.
  5. D) DNA looping brings transcriptional activator proteins, general transcription factors, sigma factor and RNA Pol II together.
  6. E) DNA looping brings transcriptional activator proteins, general transcription factors, mediator complex and RNA Pol II together.

 

 

  1. What is the name of the enzyme complex that forms at the start of transcription?
  2. A) DNA polymerase
  3. B) RNA polymerase
  4. C) DNA gyrase
  5. D) RNA helicase

 

 

  1. Which of the following molecules is made during the process of transcription?
  2. A) mRNA
  3. B) tRNA
  4. C) rRNA
  5. D) All of these choices are correct.

 

 

  1. If you made a change in the promoter sequence in the DNA that inactivates the promoter, what would happen at the RNA level?
  2. A) Nothing, the RNA would be made as usual.
  3. B) The mutation of the DNA would be carried through to the RNA sequence.
  4. C) The RNA polymerase would not be able to recognize and bind the DNA, so no RNA would be made.
  5. D) The DNA helicase would not be able to recognize and bind the DNA, so the RNA would not be made.

 

 

  1. Whichever DNA strand is transcribed, the RNA polymerase reads the template strand from 3 to 5.
  2. A) True
  3. B) False

 

 

  1. In an RNA world:
  2. A) RNA functions for information storage and proteins do catalysis.
  3. B) DNA functions for information storage and RNA does catalysis.
  4. C) RNA functions for information storage and for catalysis.
  5. D) RNA functions for information storage and there is no catalysis.
  6. E) None of the other answer options is correct.

 

 

  1. Which of the following is essential, even in an RNA world?
  2. A) polymerase
  3. B) transcription
  4. C) translation
  5. D) spliceosomes
  6. E) transfer RNA

 

 

  1. RNA catalysis can be selected in laboratory experiments.
  2. A) True
  3. B) False

 

 

  1. RNA catalysis means that RNA can:
  2. A) function as an information-storage molecule.
  3. B) function as a signaling molecule.
  4. C) form membrane-like structures.
  5. D) function like an enzyme.

 

 

  1. In E. coli the molecule(s) responsible for promoter recognition is/are referred to as:
  2. A) the sigma factor.
  3. B) the TATA box.
  4. C) the mediator complex.
  5. D) an enhancer.
  6. E) transcription factors.

 

 

  1. In eukaryotes, activator proteins bind to _____; generalized transcription factors bind to _____.
  2. A) promoters; terminators
  3. B) DNA polymerases; RNA polymerases
  4. C) promoters; enhancers
  5. D) terminators; RNA polymerases
  6. E) enhancers; promoters

 

 

  1. In eukaryotes, where do general transcription initiation factors bind?
  2. A) 5′ UTR
  3. B) promoter
  4. C) donor splice site
  5. D) near the start codon
  6. E) 5′ cap

 

 

  1. During transcription of a given protein-coding gene, both strands are used as template.
  2. A) True
  3. B) False

 

 

  1. In a long double-stranded DNA molecule containing the genetic information for many genes, the template strand for one gene may be the nontemplate strand for another gene along the way.
  2. A) True
  3. B) False

 

 

  1. Which of the following numbers is closest to the number of bases of RNA that at any one time are hydrogen bonded to DNA within an RNA polymerase in E. coli?
  2. A) 1
  3. B) 10
  4. C) 100
  5. D) 1000
  6. E) 10,000

 

 

  1. Where does the energy come from to add a uracil to the 3′ end of a transcript?
  2. A) the energy released by allowing the uracil to complementary base pair with an adjacent thymine
  3. B) the hydrolysis of a terminal phosphate from the incoming UTP molecule
  4. C) the cell’s supply of ATP
  5. D) the hydrolysis of pyrophosphate from the incoming UTP molecule
  6. E) the hydrolysis of all three phosphate groups from the incoming UTP molecule

 

 

  1. Which one of the following statements about RNA is CORRECT?
  2. A) RNA is a more stable molecule than DNA.
  3. B) RNA has the same 5-carbon sugars as DNA.
  4. C) RNA uses the same pyrimidine bases as DNA.
  5. D) RNA uses the same purine bases as DNA.
  6. E) All of these choices are correct.

 

 

  1. What would happen if an enhancer sequence were mutated so that its binding partner was always bound and recruiting the RNA polymerase complex?
  2. A) No transcription would occur as the site is now blocked to other proteins.
  3. B) Transcription wouldn’t change.
  4. C) No transcription would occur because the mediator complex could not form.
  5. D) Transcription would occur continuously.

 

 

  1. A template strand of DNA is read in the _____ direction in order to direct synthesis of RNA in the _____ direction.
  2. A) 3’–5′; 3’–5′
  3. B) 5’–3′; 3’–5′
  4. C) 3’–5′; 5’–3′
  5. D) 5’–3′; 5’–3′

 

 

  1. Transcription continues until:
  2. A) all bases in the DNA are copied.
  3. B) a stop codon is encountered.
  4. C) a terminator sequence is encountered.
  5. D) a ribosome pulls RNA polymerase off the DNA.
  6. E) a transcription factor signals the end of the gene.

 

 

  1. Based on what you know about eukaryotic cells, what is one of the arguments against using RNA as the genetic storage molecule?
  2. A) Because RNA uses uracil instead of thymine, it cannot hold genetic information.
  3. B) RNA has a negatively charged sugar phosphate backbone.
  4. C) The structure of RNA does not allow for double-stranded base pairing.
  5. D) There is no current mechanism to package enough RNA to encode all the information needed by the cell.
  6. E) The secondary structure of RNA prevents its replication before cell division.

 

 

  1. Based on what you know about eukaryotic cells, what is one of the arguments against using RNA as the genetic storage molecule?

 

 

  1. The idea that, when life originated on Earth, a macromolecule other than DNA served the role of information storage and that this same macromolecule carried out catalysis is called the _____ hypothesis.
  2. A) water world
  3. B) carbon world
  4. C) macromolecular world
  5. D) RNA world

 

 

  1. The experiment of replicating RNA, introducing random mutations, and repeating the process on a small subset of products able to carry out a specific chemical reaction mimics the process of:
  2. A) DNA replication.
  3. B)
  4. C)
  5. D) natural selection.

 

 

  1. Ribose differs from deoxyribose in that a ribose:
  2. A) has an extra hydroxyl group.
  3. B) is missing a hydroxyl group.
  4. C) has an extra phosphate group.
  5. D) is missing a phosphate group.

 

 

  1. The base uracil pairs with:
  2. A)
  3. B)
  4. C)
  5. D)

 

 

  1. Some RNA molecules possess catalytic activity.
  2. A) True
  3. B) False

 

 

  1. The type of RNA that physically interacts with a ribosome, providing the sequence information for a specific protein, is abbreviated:
  2. A)
  3. B)
  4. C)
  5. D)
  6. E)

 

 

  1. In an RNA world:
  2. A) RNA functions in information storage and proteins do catalysis.
  3. B) DNA functions in information storage and RNA alone catalyzes reactions.
  4. C) RNA functions in information storage and for catalysis.
  5. D) RNA functions in information storage and there is no catalysis.
  6. E) None of the other answer options is correct.

 

 

  1. RNA catalysis can be selected in laboratory experiments.
  2. A) True
  3. B) False

 

 

  1. The production of an RNA molecule using DNA as a template is referred to as _____.

 

 

  1. An RNA transcript is synthesized in which direction?
  2. A) N terminus to C terminus
  3. B) C terminus to N terminus
  4. C) 5′ to 3′
  5. D) 5′ to 5′
  6. E) 3′ to 5′

 

 

  1. The same strand in a DNA double helix is used as the template strand for transcription of every gene in a given chromosome.
  2. A) True
  3. B) False

 

 

  1. In order for a nucleotide to be added to a growing RNA strand, the polymerase ensures that hydrogen bonds between the incoming base and the template strand are properly made before the high-energy phosphate bond is cleaved.
  2. A) True
  3. B) False

 

 

  1. In a bacterial transcription complex, how many base pairs of RNA-DNA hybrid are found?
  2. A) 2
  3. B) 8
  4. C) 25
  5. D) 35
  6. E) 100

 

 

  1. Transcription starts at a _____ and ends at a _____.
  2. A) promoter; terminator
  3. B) 5′ cap; terminator
  4. C) promoter; 5′ end
  5. D) 3′ end; 5′ end

 

 

  1. Transcriptional activator proteins bind to a specific DNA sequence referred to as a(n) _____.

 

 

  1. A polymerization reaction is made irreversible by:
  2. A) hybridization of a free nucleotide to a template.
  3. B) breaking of the bond between the 2′ carbon and the hydroxyl group.
  4. C) creation of a phosphodiester bond.
  5. D) hydrolysis of a pyrophosphate group into two inorganic phosphates.
  6. E) the entry of a free nucleotide into an RNA polymerase.

 

 

  1. Which one of the following is NOT a way in which RNA differs from DNA?
  2. A) RNA has uracil as one of its bases and DNA has thymine.
  3. B) RNAs are typically single-stranded and DNA is double-stranded.
  4. C) RNA nucleotides can have only a single phosphate group and DNA nucleotides have one, two, or three phosphate groups.
  5. D) RNA molecules are usually much shorter than DNA molecules.
  6. E) The sugar component of RNA nucleotides is ribose and the sugar component of DNA nucleotides is deoxyribose.

 

 

  1. A transcribed region of DNA has a 5′ to 3′ sequence TTCATGGCGAC. The 5′ to 3′ sequence of an RNA transcribed from this DNA would be 5′-_____-3′.

 

 

  1. Many promoters of a hypothetical conserved gene have mostly adenines and thymines. What is the MOST likely reason for this high proportion of adenines and thymines?
  2. A) RNA polymerases are better at incorporating uracils and thymines into RNA molecules than incorporating guanines and cytosines.
  3. B) This is the region for separating template and nontemplate strands, and A-T base pairs are easier to separate than G-C base pairs.
  4. C) Accessory proteins like sigma factors or transcription factors bind more easily to AT-rich sequences than they do to GC-rich sequences.
  5. D) It is possible to create more unique sequences for recognition with adenines and thymines than it is with guanines and cytosines.
  6. E) None of the other answer options is correct.

 

 

  1. Mutations only occur in DNA, and never are observed in RNA.
  2. A) True
  3. B) False

 

 

  1. Which of the following statements about RNA is FALSE?
  2. A) RNA is not as stable as DNA.
  3. B) RNA contains uracil.
  4. C) RNA is typically single-stranded.
  5. D) RNA can be produced via transcription.
  6. E) RNA contains equal proportions of G and C nucleotides.

 

 

  1. When RNA is transcribed, the RNA/DNA complex extends for the entire length of the DNA sequence of interest.
  2. A) True
  3. B) False

 

 

  1. An intron is:
  2. A) a polypeptide that is clipped out of a larger protein post-translationally.
  3. B) an RNA sequence that is removed during the processing of an RNA molecule in the nucleus.
  4. C) part of an intact, mature mRNA that leaves the nucleus.
  5. D) part of an RNA transcript that is not present in the DNA template.
  6. E) a type of transfer RNA.

 

 

  1. An exon is:
  2. A) a protein that is clipped out post-translationally.
  3. B) RNA that is removed during the processing of an RNA molecule and remains inside the nucleus.
  4. C) part of an intact, mature mRNA that leaves the nucleus.
  5. D) a transfer RNA that binds to the codon.
  6. E) a series of amino acids at the end of a new polypeptide that directs transcription to the ER.

 

 

  1. What is an intron?

 

 

  1. What is an exon?

 

 

  1. In order to test the effects of a new drug, you isolate the messenger RNA molecules from both treated and untreated eukaryotic cells and separate them according to size using gel electrophoresis. In each lane of the gel, the shorter RNA molecules migrate more quickly through the gel and end up near the bottom of the gel while the longer RNAs migrate more slowly and remain near the top.

 

 

The samples that were loaded into each of the four lanes are as follows:

 

Lane 1: the primary RNA transcripts isolated from the nucleus of untreated cells

Lane 2: the primary RNA transcripts isolated from the nucleus of cells treated with the drug being tested

Lane 3: RNA isolated from the cytosol of untreated cells

Lane 4: RNA isolated from the cytosol of cells treated with the drug being tested

 

Which of the following conclusions is most likely to be CORRECT?

  1. A) These results suggest that the drug inhibits post-translational processing of this gene.
  2. B) These results suggest that the drug contains a protease that targets this gene product.
  3. C) These results suggest that the drug digests DNA.
  4. D) These results suggest that the drug affects RNA processing.
  5. E) These results suggest that the drug inhibits DNA replication.

 

 

  1. In order to test the effects of a new drug, you isolate the messenger RNA molecules from both treated and untreated eukaryotic cells and separate them according to size using gel electrophoresis. In each lane of the gel, the shorter RNA molecules migrate more quickly through the gel and end up near the bottom of the gel while the longer RNAs migrate more slowly and remain near the top.

 

 

The samples that were loaded into each of the four lanes are as follows:

 

Lane 1: the primary RNA transcripts isolated from the nucleus of untreated cells

Lane 2: the primary RNA transcripts isolated from the nucleus of cells treated with the drug being tested

Lane 3: RNA isolated from the cytosol of untreated cells

Lane 4: RNA isolated from the cytosol of cells treated with the drug being tested

Based on the information provided by the gel shown above, what cellular process appears to be affected by the new drug?

 

 

  1. List two features of polycistronic mRNAs.

 

1. Which property of membrane phospholipids allows membrane proteins involved in the same biochemical pathway to associate with each other?

 

 

2. Purified phospholipids gather together and form membranes only if the appropriate enzyme is present.
A) True
B) False

 

 

3. Which component of a phospholipid is found in the interior of a lipid bilayer?
A) glycerol
B) fatty acids
C) phosphate group

 

 

4. Phospholipids spontaneously form a variety of structures in aqueous solution. This property accounts at least in part for which of the following?
A) the first cells
B) formation of lipid bilayers
C) the ability of vesicles to fuse with the plasma membrane (exocytosis)
D) the ability of vesicles to bud off from the plasma membrane (endocytosis)
E) All of the answer options depend on this property of phospholipids.

 

 

5. The lipid components of cellular membranes often include:
A) phospholipids.
B) phospholipids and fatty acids.
C) fatty acids and cholesterol.
D) phospholipids and cholesterol.

 

 

6. List the lipid components of cellular membranes.

 

 

7. In response to seasonal changes in temperature, many organisms must alter the composition of their plasma membranes to maintain the proper degree of fluidity. As summer turns to fall and eventually into winter, which of the following would you predict you would observe in the plasma membranes of organisms that are unable to regulate their body temperature?
A) an increase in phospholipid fatty acid side chain length and an increase in side chain saturation
B) a decrease in phospholipid fatty acid side chain length and an increase in side chain saturation
C) a decrease in phospholipid fatty acid side chain length and a decrease in side chain saturation
D) an increase in phospholipid fatty acid side chain length and a decrease in side chain saturation

 

 

8. In order for bilayers to form spontaneously, the pH of the solution should be:
A) very acidic.
B) moderately acidic.
C) approximately neutral.
D) moderately basic.
E) very basic.

 

 

9. The first cells were surrounded by a membrane composed largely of lipids synthesized by intracellular proteins.
A) True
B) False

 

 

10. Paramecium is a unicellular organism that lives in fresh water. Suppose you are studying two populations of this organism: one population lives in a pond in northern Ontario, Canada, and the other lives in a pond in southern Florida. If you examined the plasma membranes of both of these populations at the same time of year, what difference would you expect to find between the two populations’ cell membranes?
A) The fatty acid side chains in the membrane phospholipids of the Florida Paramecia would generally be longer and would be more saturated compared to those in the membranes of the Canada Paramecia.
B) The fatty acid side chains in the membrane phospholipids of the Florida Paramecia would generally be shorter and would be more saturated compared to those in the membranes of the Canada Paramecia.
C) The fatty acid side chains in the membrane phospholipids of the Florida Paramecia would generally be longer and would be less saturated compared to those in the membranes of the Canada Paramecia.
D) The fatty acid side chains in the membrane phospholipids of the Florida Paramecia would generally be shorter and would be less saturated compared to those in the membranes of the Canada Paramecia.

 

 

11. Freeze fracture is a technique used to visualize membrane proteins. In this technique, cells are rapidly frozen and then split, separating the lipid bilayer into its two component layers. Transmembrane proteins stay associated with one layer and leave a pit in the other. The fluid mosaic model predicts what kind of pattern of proteins and pits?
A) a random arrangement of proteins and pits
B) a random arrangement of proteins, but an ordered arrangement of pits
C) an ordered arrangement of proteins, but a random arrangement of pits

 

 

12. Molecules that have both hydrophilic and hydrophobic regions are referred to as _____.

 

 

13. Specific types of lipids assemble into defined areas of a biological membrane referred to as:
A) sphingopatches.
B) lipid rafts.
C) biomembrane aggregation regions (BARs).
D) plaques.
E) cholesterol plugs.

 

 

14. Which one of the following describes the hydrophilic component of cholesterol?
A) a hydroxyl group only
B) a phosphate group only
C) a phosphate group and a chemical group called choline
D) a group of four planar rings and a hydroxyl group
E) a single hydrocarbon tail

 

 

15. Which one of the following is considered an integral membrane protein?
A) a protein with its N-terminus in the cytoplasm and its C-terminus in the extracellular space
B) a protein attached to a transmembrane protein via hydrogen bonding
C) a protein attached to a phospholipid via ionic bonding with the head group of the lipid molecule
D) a protein capable of diffusing throughout the cytoplasm of a cell

 

 

16. Of the major taxonomic groups of organisms mentioned in Chapter 1 (Section 1.3), list those whose cells have a plasma membrane.

 

 

17. Many environmental factors influence the structure of biological membranes. Which one of the following could permanently disrupt phospholipid bilayers in an aqueous solution?
A) the addition of acid to change the pH
B) physical agitation of the solution
C) slight elevation of the temperature

 

 

18. Explain how the basic structure of a phospholipid bilayer is maintained in an aqueous solution, and identify a change you can make that would permanently disrupt the bilayer.

 

 

19. Phospholipase is an enzyme that cleaves the phosphate head group off a phospholipid molecule.  The plasma membrane is not, however, permeable to the enzyme.  Imagine a cell where phospholipid A is present in the layer of phospholipds facing the exterior of the cell, and phospholipid B is present in the layer of phospholipds facing the interior of the cell.  After adding phospholipase to the medium in which the cell is growing, what would you expect to find in the fluid surrounding the cell?
A) the phosphate head group from phospholipid A only
B) the phosphate head group from phospholipid B only
C) phosphate head groups from both phospholipids A and B
D) phosphate head groups from neither phospholipids A nor B

 

 

20. Which of the following would be expected to decrease the fluidity of a membrane?
A) an increase in phospholipid fatty acid chain length and an increase in chain saturation
B) a decrease in phospholipid fatty acid chain length and an increase in chain saturation
C) a decrease in phospholipid fatty acid chain length and a decrease in chain saturation
D) an increase in phospholipid fatty acid chain length and a decrease in chain saturation

 

 

21. Why does a phospholipid on the cytoplasmic side of the cell membrane rarely flip to the extracellular side if both environments are polar?
A) The polar head group cannot pass through the nonpolar interior.
B) The two sides have different functions and thus the phospholipid would not function properly.
C) The cytoplasmic phospholipid is too big to pass through the membrane.
D) The cholesterol does not allow lipids to move.

 

 

22. If FRAP is performed on two membranes, one at 25ºC and the other at 40ºC, which one of the following results would most likely be observed?
A) Only the membrane at the higher temperature would recover fluorescence in the bleached area.
B) Only the membrane at the lower temperature would recover fluorescence in the bleached area.
C) Both membranes would recover fluorescence in the bleached area, but the membrane at the colder temperature would recover more rapidly.
D) Both membranes would recover fluorescence in the bleached area, but the membrane at the warmer temperature would recover more rapidly.
E) Both membranes would recover fluorescence in the bleached area at the same rate.

 

 

23. A spontaneously generated enclosed bilayer structure is called a(n) _____.

 

 

24. Figure 5.2 shows a common biological phospholipid called phosphatidyl choline.  Which of the following is NOT a component of phosphatidyl choline?

 

A) glycerol
B) choline
C) phosphate
D) three fatty acids
E) None of the answer options is correct.

 

 

25. Exposure of purified phospholipids to water results in the spontaneous formation of:
A) lipid bilayers.
B) triacylglycerols.
C) steroids.
D) polypeptides.
E) carbohydrates.

 

 

26. Which one of the following is NOT a component of an animal cell’s plasma membrane?
A) protein
B) lipid
C) nucleic acid
D) carbohydrate

 

 

27. Amino acids with hydrophobic side chains are often found in the region of an integral membrane protein that spans the membrane.
A) True
B) False

 

 

28. Long, saturated fatty acid tails _____ lipid mobility and _____ membrane fluidity.
A) enhance; increase
B) reduce; increase
C) maintain; decrease
D) enhance; maintain
E) reduce; decrease

 

 

29. Which of the following is a common function of membrane proteins? (Select all that apply.)
A) catalysis
B) attachment
C) transport
D) signal reception

 

 

30. What type of molecule is NOT associated with a cell’s plasma membrane?
A) carbohydrate
B) phospholipid
C) RNA
D) protein

 

 

31. The interior region of a phospholipid bilayer is characterized as:
A) hydrophilic.
B) hydrophobic.
C) polar.
D) hydrophilic and polar.

 

 

32. A phospholipid molecule in a membrane can:
A) spin (rotate around its vertical axis).
B) move side to side (lateral movement).
C) flip (rotate between the two halves of the bilayer).
D) both spin (rotate around its vertical axis) and move side to side (lateral movement).

 

 

33. Which part of a cholesterol molecule is polar?
A) the OH group
B) the four interconnected planar rings
C) the hydrocarbon tail
D) both the four interconnected planar rings and the hydrocarbon tail

 

 

34. A protein that is temporarily associated with a biological membrane is a(n):
A) transmembrane protein.
B) integral membrane protein.
C) peripheral membrane protein.
D) transmembrane protein and an integral membrane protein.

 

 

35. An amphipathic molecule is one that:
A) contains both polar and nonpolar regions.
B) has a head and tail domain.
C) makes up a membrane.
D) can fully dissolve in water.

 

 

36. How is a micelle different from a liposome?
A) A micelle is composed of a single layer of phospholipids.
B) Micelle phospholipids have bulky head groups.
C) Micelle phospholipids have a single fatty acid tail.
D) All of these choices are correct.

 

 

37. Some lipid rafts are characterized by an accumulation of cholesterol. What does this mean for the fluidity of the raft domain?
A) These lipid rafts are more fluid than the surrounding membrane at normal temperatures.
B) These lipid rafts are less fluid than the surrounding membrane at normal temperatures.
C) These lipid rafts are equally fluid as the surrounding membrane independent of temperature.
D) These lipid rafts are less fluid than the surrounding membrane at low temperatures.

 

 

38. Predict how phospholipids arrange themselves when they are placed in a nonpolar solution.
A) The phospholipid heads would orient toward the solution.
B) The phospholipid tails would orient toward the solution.
C) The phospholipids would form a bilayer.
D) The phospholipid would form a liposome.

 

 

39. Which of the following lipid composition options has the LEAST membrane fluidity?
A) phospholipids with long-chain, saturated fatty acids
B) phospholipids with long-chain, unsaturated fatty acids
C) phospholipids with short-chain, saturated fatty acids
D) phospholipids with short-chain, unsaturated fatty acids

 

 

40. A single molecule is always either hydrophobic or hydrophilic, and can never possess (at the same time) a region that is hydrophobic and a region that is hydrophilic.
A) True
B) False

 

 

41. A researcher is using a modified version of FRAP. She has devised a technique that allows her to label all the peripheral membrane proteins with a fluorescent tag, and has bleached a specific area of the cell membrane.  After 24 hours, she notices that fluorescence has returned to the bleached area.  What can she deduce from this experiment?
A) Peripheral membrane proteins may not be permanently associated with the cell membrane.
B) Peripheral membrane proteins—like transmembrane proteins—are located within the cell membrane.
C) Peripheral membrane proteins can move freely within the cell membrane.
D) Peripheral membrane proteins are akin to integral membrane proteins.
E) Peripheral membrane proteins can both move freely within the cell membrane and are akin to integral membrane proteins.

 

 

42. Imagine a cell that has a membrane composed mostly of lipids with saturated fatty acid tails, and that this membrane also has low cholesterol content.  What are the characteristics of this cell membrane?
A) The lipids would be able to easily transition between the inner and outer layers of the bilayer constituting the cell membrane.
B) The lipids contained in such a membrane would be highly mobile, and in near constant flux.
C) Due to its cholesterol content, the cell membrane would remain fluid even at cold temperatures.
D) The characteristics of this cell membrane will closely mirror those of a membrane composed of only unsaturated fatty acids.
E) None of the answer options is correct.

 

 

43. If cells had single-layer membranes like micelles, how would the structures of transmembrane proteins be affected?
A) Transmembrane proteins would only possess hydrophobic regions.
B) Transmembrane proteins would only possess hydrophilic regions.
C) Transmembrane proteins would possess a hydrophobic region in the cell interior and a hydrophilic region in the extracellular space.
D) Transmembrane proteins would possess a hydrophilic region in the cell interior and a hydrophobic region in the extracellular space.
E) The structures of transmembrane proteins would remain the same as if cells had lipid bilayers.

 

 

44. Which one of the following molecules would MOST likely require a transport protein to cross the plasma membrane of a red blood cell?
A) CO2
B) H2O
C) O2
D) C6H12O6

 

 

45. Explain why the plasma membrane is permeable to some substances, while others require a channel, or carrier, protein to cross the membrane.

 

 

46. Some diseases result from defective transport across the membrane. For example, cystic fibrosis results when a chloride ion transporter does not function. Which of the following is affected when this transporter does NOT function?
A) the chloride concentration gradient
B) the electrical gradient of the cell
C) both the chloride concentration gradient and the electrical gradient of the cell
D) neither the chloride gradient nor the electrical gradient of the cell

 

 

47. Suppose you are studying the transport of a certain polar molecule across the plasma membrane of cells in culture. Over a period of time, you measure the concentration of a polar molecule inside and outside of the cells. You find that the concentration of the molecule is lower in the cell but is gradually increasing. You also measure the ATP concentration inside the cell and find that it is not changing. Which of the following is probably responsible for the transport of this polar substance into the cell?
A) facilitated diffusion
B) secondary active transport
C) endocytosis
D) active transport
E) simple diffusion

 

 

48. Suppose you are studying the transport of a certain polar molecule across the plasma membrane of cells in culture. Over a period of time, you measure the concentration of a polar molecule inside and outside of the cells. You find that the concentration of the molecule is higher in the cell and is gradually increasing. You also measure the ATP concentration inside the cell and find that it is decreasing. Which of the following is probably responsible for the transport of this polar substance into the cell?  (Select all that apply.)
A) facilitated diffusion
B) secondary active transport
C) endocytosis
D) active transport
E) simple diffusion

 

 

49. The beaker in the illustration below contains two solutions of salt with different concentrations (measured by molarity, M). The two solutions are separated by a membrane that is permeable to both salt and water.

 

Which of the following will occur in this container?

A) Net diffusion of water from B to A and of salt from A to B.
B) Net diffusion of water from A to B and of salt from B to A.
C) Net diffusion of water across the membrane, but not of salt.
D) Diffusion of salt across the membrane, but not of water.
E) Net diffusion of salt from B to A, but no net diffusion of water.

 

 

50. The beaker in the illustration below contains two solutions of salt with different concentrations (measured by molarity, M). The two solutions are separated by a membrane that is permeable to both salt and water.

 

Which of the following will occur in this container?

A) Diffusion of water from B to A and of salt from A to B.
B) Net diffusion of water across the membrane, but not of salt.
C) Diffusion of salt across the membrane, but not of water.
D) Net diffusion of salt from B to A, but no net diffusion of water.

 

 

51. Some drugs are now being delivered into cells through liposomes, in which the drug is surrounded by a phospholipid bilayer.  How do the drugs enter into the cell?
A) The drug destroys the liposome and diffuses into the cell.
B) The liposome cuts a hole in the cell membrane and injects the drug into the cell.
C) The liposome fuses with the phospholipid bilayer of the cell.
D) Protein channels on the cell surface transport the liposomes into the cell.

 

 

52. Some drugs are now being delivered into cells through liposomes, in which the drug is surrounded by a phospholipid bilayer.  Explain how the drugs enter the cell.

 

 

53. The plasma membranes of some plant cells use transport proteins to move protons out of the cell against their concentration gradient. This is an example of:
A) facilitated diffusion.
B) passive transport.
C) endocytosis.
D) active transport.
E) simple diffusion

 

 

54. Which of the following represents the order that molecules cross a synthetic membrane composed of phospholipids but not proteins, from most easily (freely permeable) to least easily (not permeable)?
A) O2, sodium ions (Na+), water (H2O), glucose
B) O2, water (H2O), glucose, sodium ions (Na+)
C) sodium ions (Na+), glucose, water (H2O), O2
D) water (H2O), glucose, sodium ions (Na+), O2
E) glucose, water (H2O), O2, sodium ions (Na+)

 

 

55. G protein-coupled receptors are transmembrane receptors involved in cell signaling. The amino acid sequence of these proteins reveals that the polypeptide chain of the protein has seven hydrophobic regions. Based on this information, what can you conclude about how the protein is associated with the cell membrane?
A) The receptor is likely to be a peripheral membrane protein.
B) The polypeptide chain is likely to span the membrane once.
C) The polypeptide chain is likely to span the membrane seven times.
D) The polypeptide chain is likely to span the membrane fourteen times.
E) The receptor is likely to be synthesized on free ribosomes.

 

 

56. Some plant cells take advantage of the high concentration of protons outside the cell to move solutes, such as sucrose, across the plasma membrane into the cell where the sucrose concentration is already relatively high. This type of transport is an example of:
A) facilitated diffusion.
B) osmosis.
C) secondary active transport.
D) passive transport.

 

 

57. Which of the following is responsible, in part, for keeping the cytoplasm of red blood cells isotonic with the blood plasma, and thereby preventing either lysis or shrinking of the cells?
A) facilitated diffusion
B) sodium channels
C) the sodium/potassium pump
D) osmosis

 

 

58. The active maintenance of a constant internal environment is referred to as:
A) homeostasis.
B) equilibrium.
C) stability.
D) symmetry.
E) balance.

 

 

59. The electrical component of an electrochemical gradient is due to:
A) the use of ATP as an energy source to drive primary transport.
B) a greater concentration of positive charges on the side of the membrane with the lowest concentration of protons.
C) a higher pH on the side of the membrane with the highest concentration of protons.
D) a higher pH on the side of the membrane with the lowest concentration of protons.
E) a greater concentration of positive charges on the side of the membrane with the highest concentration of protons.

 

 

60. A beaker contains two solutions of salt dissolved in water. The two solutions have different concentrations (measured by molarity, M) and are separated by a membrane that is permeable to both salt and water.

 

Which of the following statements is TRUE?

A) There will be a net movement of salt from side A to side B
B) There will be a net movement of salt, but net movement of water will not occur.
C) There is more water in side A than there is in side B.

 

 

61. In intestinal epithelial cells, a transport protein moves glucose into the cytoplasm against its concentration gradient at the same time that it transports Na+ into the cell down its electrochemical gradient. Which of the following CORRECTLY describes this cotransport of glucose and sodium?
A) Primary active transport by a symporter.
B) Secondary active transport by an antiporter.
C) Secondary active transport by a symporter.
D) Primary active transport by an antiporter.

 

 

62. The sodium-potassium pump is an example of:
A) a symporter.
B) passive transport.
C) an antiporter.
D) channel-mediated diffusion.
E) None of the answer options is correct.

 

 

63. The MOST abundant organic molecule in nature is:
A) water.
B) cellulose.
C) aquaporin.
D) cholesterol.
E) ATP.

 

 

64. Which of the following represents how easily the molecules cross a synthetic membrane composed of phospholipids but not proteins, from most easily (freely permeable) to least easily (not permeable)?
A) hydrophobic molecules, ions, small polar molecules, large polar molecules
B) hydrophobic molecules, small polar molecules, large polar molecules, ions
C) ions, large polar molecules, small polar molecules, hydrophobic molecules
D) small polar molecules, large polar molecules, ions, hydrophobic molecules
E) large polar molecules, small polar molecules, hydrophobic molecules, ions

 

 

65. A beaker contains two solutions of salt dissolved in water. The two solutions have different concentrations (measured by molarity, M) and are separated by a membrane that is permeable to both salt and water.

 

Which of the following statements is TRUE?

A) Side A is hypotonic relative to side B.
B) Side A is isotonic relative to side B.
C) Side A is hypertonic relative to side B.

 

 

66. A beaker contains two solutions of glucose dissolved in water. The two solutions have different concentrations (measured by molarity, M) and are separated by a membrane that is permeable to water, but not to glucose.

 

 

Which of the following statements is TRUE?

A) There will be net movement of glucose from B to A.
B) The volume will increase in side B of the beaker.
C) There will be net movement of water from B to A.
D) The system will not reach equilibrium.

 

 

67. You are studying the transport of a particular substance into epithelial cells grown in culture. You notice that you can only find the substance inside the cell when ATP is present. How is the protein moving through the membrane?
A) diffusion
B) facilitated diffusion
C) passive transport
D) active transport

 

 

68. Which way does the water move if the cell is in a hypotonic environment?
A) out of the cell
B) into the cell
C) Water doesn’t move across the hydrophobic core of cell membranes.

 

 

69. In certain cells, a transport protein moves one calcium ion out of the cell against its concentration gradient while allowing the movement of three sodium ions into the cell down sodium’s electrochemical gradient. Which of the following CORRECTLY describes this cotrannsport of calcium and sodium?
A) primary active transport by a symporter
B) secondary active transport by an antiporter
C) secondary active transport by a symporter
D) primary active transport by an antiporter

 

 

70. Which of the following have cell walls? (Select all that apply.)
A) plant cells
B) animal cells
C) fungal cells
D) bacterial cells

 

 

71. Which of the following organisms have complex carbohydrates as a major component of their cell walls? (Select all that apply.)
A) animals
B) bacteria
C) fungi
D) plants

 

 

72. On most bicycles, the tires include a separate inner tube inside the tire itself. When the inner tube is inflated, often to pressure greater than 100 pounds per square inch, it does not burst because the walls of the tire support it. Without the tire, the inner tube would burst long before such high pressures were reached. Similarly, the cytoplasm of plant cells in hypotonic conditions is under relatively high osmotic pressure. However, the cells do not lyse (or burst) due to the presence of the _____ that provides structural support for the _____.
A) cell wall; plasma membrane
B) cell wall; contractile vacuoles
C) plasma membrane; contractile vacuoles
D) contractile vacuoles; plasma membrane
E) contractile vacuole; cell wall

 

 

73. Which one of the following is LEAST likely to cross a lipid bilayer?
A) O2
B) CO2
C) ATP
D) H2O
E) N2

 

 

74. Passive transport of a molecule across a lipid bilayer only occurs if there is a significant difference in the concentration of that molecule from one side of the bilayer to the other.
A) True
B) False

 

 

75. The movement of water across a selectively permeable membrane from an area of lower solute concentration to an area of higher solute concentration is referred to as _____.

 

 

76. The random movement of molecules is referred to as:
A) transport.
B) osmosis.
C) diffusion.
D) All of these choices are correct.

 

 

77. The term homeostasis refers to the ability of:
A) molecules to undergo net movement by diffusion.
B) the cell to seek out an optimal environment.
C) the plasma membrane to control what enters a cell.
D) the cell to control and maintain its internal environment.

 

 

78. What factors are required for net movement of a substance to occur by facilitated diffusion?
A) a concentration gradient
B) a plasma membrane
C) a transport protein
D) All of these choices are correct.

 

 

79. The movement of water into, or out of, a cell is an example of:
A) osmosis.
B) lysis.
C) diffusion.
D) active transport.
E) both osmosis and diffusion.

 

 

80. Why does active transport require ATP?
A) An input of energy is needed to speed up the rate of facilitated diffusion.
B) An input of energy is needed to allow the movement of molecules from an area of low concentration to one of higher concentration.
C) An input of energy is needed to maintain the conformation of transport proteins.
D) An input of energy is needed to both speed up the rate of facilitated diffusion and maintain the conformation of transport proteins.

 

 

81. What is the function of the contractile vacuole?
A) to help single-celled organisms maintain homeostasis in a hypotonic environment
B) to help single-celled organisms change shape in response to environmental changes
C) to help single-celled organisms maintain homeostasis in a hypertonic environment
D) to maintain cell shape through turgor pressure

 

 

82. Turgor pressure is the result of:
A) the activity of the contractile vacuole.
B) water accumulation within a cell.
C) the rigidity of the plasma membrane.
D) All of these choices are correct.

 

 

83. A cell’s plasma membrane contributes to homeostasis by:
A) acting as a selective barrier.
B) defining the boundary between the inside and outside of the cell.
C) functioning as a fluid mosaic of lipid and protein.
D) maintaining the shape of the cell.

 

 

84. Which of the following molecules does NOT easily diffuse across a plasma membrane?
A) small polar molecules
B) large polar molecules
C) gases
D) both small and large polar molecules

 

 

85. The process of diffusion requires:
A) a concentration gradient.
B) ATP.
C) the random movement of molecules.
D) transport proteins.

 

 

86. Which one of the following is an example of secondary active transport?
A) the use of an electrochemical gradient of one molecule to move a second molecule
B) the movement of potassium ions following the initial movement of sodium ions
C) the use of more than one type of transport protein for the movement of a molecule
D) the use of a chemical gradient to generate an electrical gradient

 

 

87. How is a carrier protein different from a channel protein?
A) Carrier proteins use ATP, but channel proteins do not.
B) Carrier proteins undergo conformational change so that they are open alternately to one side of the membrane or the other.
C) Transport through carrier proteins depends on concentration gradients, but transport through channel proteins does not.
D) Transport through a carrier does not depend on the random motion of molecules.

 

 

88. During osmosis, water moves from a region of _____ to a region of _____.
A) high solute concentration; low solute concentration
B) high solvent concentration; low solvent concentration
C) low solute concentration; high solute concentration
D) Both “high solvent concentration; low solvent concentration” AND “low solute concentration; high solute concentration” are correct answers.

 

 

89. How is the energy stored in a molecule of ATP used by the sodium-potassium pump?
A) It is used to transport potassium ions out of the cell.
B) It is used to transport sodium ions into the cell.
C) It is used to alter the conformation of the pump protein.
D) All of these choices are correct.

 

 

90. What would be the outcome if the pump protein shown in Fig. 5.13a instead acted as a carrier that allowed protons to move from the extracellular fluid into the cytoplasm?
A) The proton electrochemical gradient would be reversed.
B) ATP could be synthesized from ADP + Pi.
C) The number of protons on either side of the membrane would equalize.
D) ATP could be synthesized from ADP + Pi and the number of protons on either side of the membrane would equalize.

 

 

91. Which of the following is TRUE about the presence or absence of plasma membranes?
A) Only animal cells have a plasma membrane. Plant cells and bacterial cells have a cell wall.
B) Plant cells and bacterial cells have a plasma membrane, but animal cells do not.
C) Plant cells and animal cells have a plasma membrane, but bacterial cells do not.
D) All cells have a plasma membrane.

 

 

92. Cells from which domain(s) of life are separated from their environment by a plasma membrane? (Select all that apply.)
A) archaea
B) bacteria
C) eukarya

 

 

93. Which one of the following is NOT considered part of the cytoplasm?
A) the endoplasmic reticulum
B) the nucleus
C) the Golgi apparatus
D) the cytoskeleton
E) None of the answer options is correct.

 

 

94. Which one of the choices below can be used to CORRECTLY complete the following sentence?

 

“All _____ have a plasma membrane.”

A) cells
B) animal and plant cells, but not bacterial cells,
C) bacterial cells, but not animal and plant cells,
D) plant and bacterial cells, but not animal cells,

 

 

95. Which one of the following organisms organizes its genome into a nucleoid?
A) fungi
B) plants
C) animals
D) archaea

 

 

96. All cells have:
A) a nucleus.
B) genetic information.
C) internal compartments.
D) a cell wall.

 

 

97. All of the following are properties of at least some prokaryotic cells EXCEPT:
A) a nucleus.
B) plasmids.
C) small size.
D) pili.

 

 

98. Which eukaryotic organelle is associated with the breakdown of macromolecules?
A) endoplasmic reticulum
B) the Golgi apparatus
C) mitochondria
D) lysosome

 

 

99. The genetic material of a prokaryotic cell is located in its:
A) nucleolus.
B) nucleus.
C) nucleoid.
D) nucleosome.

 

 

100. How do eukaryotic plant and animal cells differ from one another?
A) Animal cells have mitochondria but not chloroplasts, and plant cells have chloroplasts but not mitochondria.
B) Animal cells do not have chloroplasts and cell walls, and plant cells do.
C) Animal cells have endoplasmic reticulum and plant cells don’t.
D) Animal cells have a plasma membrane and plant cells have a cell wall.

 

 

101. Prokaryotes absorb their nutrients from the environment; however, prokaryotes also have cell walls. What can you conclude from these statements?
A) Cell walls are permeable, allowing nutrients to pass through.
B) Prokaryotes live in a hypertonic environment.
C) Osmosis drives the movement of nutrients through the cell wall.
D) Prokaryotic cell walls do not allow nutrients to pass through them.

 

 

102. Bacteria are rarely larger than 1–2 mm in size, and are typically shaped like rods, spheres, or spirals. What likely accounts for the shape and size of these prokaryotes?
A) Such shapes likely make it difficult for predators to catch bacteria.
B) Such shapes can accommodate the complex arrangements of plasmids within bacteria.
C) Such shapes facilitate the formation of pili in bacteria.
D) Such shapes maximize the surface area over which nutrients can diffuse into bacteria.
E) Such shapes both facilitate the formation of pili in bacteria and maximize the surface area over which nutrients can diffuse into bacteria.

 

 

103. Prokaryotes contain nucleoids, which are similar to nuclei in that they contain rudimentary chromosomes referred to as plasmids.
A) True
B) False

 

 

104. Which of the following eukaryotic cell structures plays a role in protein trafficking and sorting?
A) mitochondria
B) lysosomes
C) the endoplasmic reticulum
D) the Golgi apparatus
E) vacuoles

 

 

105. A researcher is very surprised to find a prokaryotic cell that is greater than 100 mm in diameter. How could this be possible?
A) A mutation has occurred that increases the size of the nucleoid by two, thereby allowing the cell to grow in diameter.
B) There may be a large vacuole in the cell, which allows nutrients to still reach all areas of the cytoplasm in the cell.
C) Plasmids within the cell carry mutations that allow the cell to grow larger in size.
D) Through pili interactions, the prokaryotic cell can grow larger in size.
E) A mutation has increased the size of the nucleoid by two, or the prokaryote can grow larger in size through pili interactions.

 

 

106. Which of the following statements is TRUE regarding cytosol?
A) Cytosol contains, and includes, organelles.
B) Cytosol is the “jelly” substance within cells.
C) Cytosol excludes organelles.
D) Cytosol includes the nucleus.
E) Cytosol is the “jelly” substance within cells and it excludes organelles.

 

 

107. Imagine that you have two blades of grass.  One is from a normal plant, and the other is from a mutant plant that cannot produce vacuoles.  How will the structures of these two blades of grass compare?
A) The grass blade from the mutant plant will appear limp compared to that from the normal plant.
B) The grass blade from the mutant plant will appear taller than that from the normal plant.
C) The grass blade from the mutant plant will be sturdier compared to that from the normal plant.
D) The grass blade from the mutant plant will appear unpigmented compared to that from the normal plant.
E) The grass blades from the mutant and normal plant will appear identical.

 

 

108. If a cell lacked a cytoskeleton, which of the following would likely be a result?
A) The cell would be unable to harness energy.
B) The cell would be unable to carry out translation.
C) The shape of the cell would be impacted.
D) Protein movement in the cell would be affected.
E) The shape of the cell would be affected and protein movement in the cell would be affected.

 

 

109. A bacterial cell, a plant cell, and an animal cell have which of the following structures in common?
A) nucleus
B) cell wall
C) vacuole
D) nucleoid
E) cytoplasm

 

 

110. Which one of the following is MOST closely related to archaea?
A) eukaryotes
B) bacteria
C) both eukaryotes and bacteria
D) neither eukaryotes nor bacteria

 

 

111. Which of the following sequences of events correctly describes the progress of a protein that will be secreted from the cell?

 

1.     SRP binds to the growing polypeptide chain and to the ribosome.

2.     Translation resumes.

3.     SRP binds to its receptor.

4.     The signal sequence is cleaved.

5.     Protein synthesis begins in the cytosol.

6.     Translation pauses.

A) 5  1  6  3  2  4
B) 5 ® 6 ® 1 ® 3 ® 2 ® 4
C) 3 ® 6 ® 1 ® 2 ® 4 ® 5

 

 

112. Put the following events in the CORRECT sequence for a protein that will be secreted from the cell.

A.     SRP binds to the growing polypeptide chain and to the ribosome.

B.     Translation resumes.

C.     SRP binds to its receptor.

D.     The signal sequence is cleaved.

E.     Protein synthesis begins in the cytosol.

F.     Translation pauses.

 

 

113. If a mutation rendered the signal recognition particle nonfunctional, what would be the MOST obvious effect on the cell?
A) Translation would not be completed for most proteins.
B) All proteins normally secreted by the cell would remain partially formed and attached to the endoplasmic reticulum.
C) Proteins destined for the nucleus would remain in the cytosol.
D) No proteins would arrive at their proper destinations within the cell.
E) All proteins normally secreted by the cell would remain in the cytosol.

 

 

114. Which of the following accurately describes the path traveled by a new protein as it is synthesized and released from the cell?
A) plasma membrane  ER  vesicle  Golgi  cytosol  external environment
B) cytosol ® ER ® Golgi ® vesicle ® plasma membrane ® external environment
C) nuclear envelope ® ER ® vesicle ® Golgi ® plasma membrane ® external environment
D) cytosol ® Golgi ® ER ® vesicle ® plasma membrane ® external environment
E) nucleus ® ER ® Golgi ® vesicle ® plasma membrane ® external environment

 

 

115. List in order each compartment that a secreted protein passes through from its initial synthesis until it is released to the outside of the cell.

 

 

116. From the following list of compartments and locations in the cell, build a pathway that a protein would follow from its initial synthesis to its secretion. Not all structures/compartments listed will necessarily be used.

 

endoplasmic reticulum

transport vesicle

lysosome

Golgi apparatus

mitochondrion

nucleus

cytosol

plasma membrane

cell wall

chloroplast

 

 

117. Imagine that you are investigating the production of insulin in normal cells to help determine the cause of faulty insulin production in cells in which insulin appears to be synthesized but fails to be secreted from the cell. You design experiments using three different pharmaceutical compounds to help pinpoint the trouble spot in the protein synthetic pathway. The first compound blocks the movement of transport vesicles in the cytoplasm. The second blocks SRP release from the ribosome and mRNA. The third compound binds to and blocks the signal sequence so that the SRP cannot recognize it.  For each of these three treatments, indicate (1) whether the protein would be made at all, and if so, (2) where in the cell you would find it.

 

 

118. Some diseases, such as Tay-Sachs, are caused by the defective breakdown of cellular components. Which of the following organelles is defective?
A) plasma membrane
B) ribosome
C) endoplasmic reticulum
D) Golgi apparatus
E) lysosome

 

 

119. Disorders of which organelle are often associated with defects in transport from compartment to compartment, resulting in poor sorting of protein components within the cell?
A) plasma membrane
B) plasmids
C) endoplasmic reticulum
D) the Golgi apparatus
E) nucleus

 

 

120. Many cellular disorders exist in which the synthesis of certain proteins and their transport to specific locations in the cell are affected. Which organelles are involved in these disorders and why?

 

 

121. You are investigating a particular cell type, and you notice that a protein normally found in the lysosome ends up being secreted from the cell. This appears to be the only thing wrong with these cells. Of the following conditions, which is the MOST likely cause of this defect in these cells?
A) The lysosome leaks the protein out of the cell.
B) One of the signal sequences on the lysosomal protein is defective.
C) Transport vesicles responsible for sorting in the cell are defective.
D) The pH of the lysosome is not low enough for the protein to remain in it.

 

 

122. You are investigating a particular cell type, and you notice that a protein normally found in the lysosome ends up being secreted out of the cell.  This appears to be the only thing wrong with these cells.  Suggest a defect that could explain this observation.

 

 

123. Insulin is a protein hormone that helps to control the level of glucose in the blood. It is secreted from specialized cells in the pancreas. Based on this information, which path does insulin take out of the cell?
A) ER membrane  vesicle membrane  plasma membrane  exterior of cell
B) vesicle ® ER ® Golgi apparatus ® exterior of cell
C) nucleus ® ER ® Golgi apparatus ® vesicle ® exterior of cell
D) ER ® Golgi apparatus ® vesicle ® exterior of cell
E) ER ® nucleus ® cytosol ® exterior of cell

 

 

124. When physicians perform organ transplants, they make sure that there is a match between the donor (the person donating the organ) and the recipient (the person receiving the organ). What feature of the cell is being matched?
A) phospholipids in the plasma membrane
B) cholesterol in the plasma membrane
C) protein channels in the plasma membrane
D) proteins pumps in the plasma membrane
E) glycyoproteins in the plasma membrane

 

 

125. During the translation of mRNA molecules, the new polypeptides are often directed to specific parts of the cell by the presence or absence of short sequences of amino acids called signal peptides. Which of the following would you expect to find in the polypeptide that will eventually fold to become a histone protein?
A) no signal peptide
B) an amino terminal signal peptide
C) an internal signal peptide
D) a signal anchor peptide

 

 

126. During the translation of mRNA molecules, the new polypeptides are often directed to specific parts of the cell by the presence or absence of short sequences of amino acids called signal peptides. Which of the following would you expect to find in the polypeptide that will eventually fold to become an ion channel protein?
A) no signal peptide
B) an amino terminal signal peptide
C) an internal signal peptide
D) a signal anchor peptide

 

 

127. During the translation of mRNA molecules, the new polypeptides are often directed to specific parts of the cell by the presence or absence of short sequences of amino acids called signal peptides. Which of the following would you expect to find in the polypeptides that will eventually fold to become ribosomal proteins?
A) no signal peptide
B) an amino terminal signal peptide
C) an internal signal peptide
D) a signal anchor peptide

 

 

128. During the translation of mRNA molecules, the new polypeptides are often directed to specific parts of the cell by the presence or absence of short sequences of amino acids called signal peptides. Which of the following would you expect to find in the polypeptides that will eventually fold to become enzymes important in photosynthesis, such as NADP+ reductase?
A) no signal peptide
B) an amino terminal signal peptide
C) an internal signal peptide
D) a signal anchor peptide

 

 

129. With which of the following is a signal-recognition particle (SRP) capable of interacting?  (Select all that apply.)
A) an SRP receptor
B) a ribosome
C) a signal sequence in a protein destined for the ER

 

 

130. Which one of the following cellular compartments does NOT have a double membrane structure separating it from the rest of the cell?
A) lysosomes
B) the nucleus
C) mitochondria

 

 

131. If a mutation rendered the signal recognition particle receptor nonfunctional such that it is no longer able to dissociate from the SRP, what would be the most obvious effect on the cell?
A) Translation of most proteins would be incomplete.
B) All proteins normally secreted by the cell would remain partially formed and attached to the endoplasmic reticulum.
C) Proteins destined for the nucleus would remain in the cytosol.
D) No proteins would arrive at their proper destinations within the cell.
E) All proteins normally secreted by the cell would remain in the cytosol.

 

 

132. The signal recognition particle and its receptor on the surface of the endoplasmic reticulum ensure that proteins destined for incorporation into cellular membranes or for export from the cell are translated into the endoplasmic reticulum so that they may be processed through the endomembrane system. If a mutation rendered the signal recognition particle receptor nonfunctional such that the receptor was no longer able to dissociate from the SRP, what would be the most obvious effect on the cell?

 

 

133. Which of the following would be synthesized in and processed by the rough endoplasmic reticulum and Golgi apparatus?
A) fatty acids and phospholipids
B) DNA polymerase and RNA polymerase
C) lysosomal enzymes
D) cytoskeletal proteins, actin and tubulin, which are found in the cytoplasm

 

 

134. Which of the following are processed in the Golgi apparatus? (Select all that apply.)
A) integral membrane proteins of the plasma membrane
B) proteins that are secreted from the cell
C) proteins that will be broken down by lysosomes
D) mRNA molecules for the removal of introns
E) enzymes required for the synthesis of phospholipids

 

 

135. RNA molecules are transported from the nucleus to the cytoplasm in eukaryotes through:
A) sodium-potassium pumps.
B) aquaporins.
C) passive diffusion.
D) budding off of the nuclear envelope.
E) nuclear pores.

 

 

136. Which one of the following is moved from one side of a lysosomal membrane to the other by a transport protein in the lysosomal membrane?
A) protons
B) broken-down macromolecules
C) enzymes capable of breaking down macromolecules being delivered from the Golgi apparatus
D) protons and broken-down macromolecules

 

 

137. A protein with an internal signal sequence is MOST likely to be located in:
A) the nucleus.
B) a mitochondrion.
C) the cytoplasm.
D) a chloroplast.
E) the extracellular space.

 

 

138. In a eukaryotic cell, how does mRNA get out of the nucleus?
A) diffusion
B) through nuclear pores
C) through the endoplasmic reticulum
D) through the Golgi apparatus

 

 

139. You notice in your experimental system that a particular protein is no longer entering the nucleus. What could have happened?
A) The signal sequence might be mutated.
B) The chaperone protein might have taken it to a different location.
C) The solute concentration might be higher inside the nucleus.
D) None of the other answer options is correct.

 

 

140. A transmembrane protein in the outer membrane of the nuclear envelope would LEAST likely be found later in which one of the following cellular locations?
A) the plasma membrane
B) a lysosomal membrane
C) a mitochondrial membrane
D) the Golgi apparatus membrane
E) the rough endoplasmic reticulum membrane

 

 

141. Which one of the following cell types would likely have the MOST extensive system of smooth endoplasmic reticulum?
A) skin cells
B) pancreatic cells that secrete digestive enzymes
C) testicular cells that secrete steroid hormones
D) central nervous system cells
E) muscle cells

 

 

142. Which of the following organelles could be considered recycling centers of eukaryotic cells?
A) the nucleus
B) mitochondria
C) lysosomes
D) Golgi apparatus
E) smooth endoplasmic reticulum

 

 

143. Which of the following is TRUE of lysosomes? (Select all that apply.)
A) The pH is often higher inside the lysosome than in the cytoplasm.
B) The concentration of protons in the lysosome is often higher than in the cytoplasm.
C) Proton pumps are sometimes found in the lysosomal membranes.
D) Lysosomes fuse with other vesicles that contain macromolecules targeted for breakdown.
E) Lysosomal membranes often contain proteins that transport amino acids, simple sugars, and nucleotides.

 

 

144. During the translation of mRNA molecules, the new polypeptides are often directed to specific parts of the cell by the presence or absence of short sequences of amino acids called signal peptides. Which of the following would you expect to find in the polypeptides that will eventually fold to become the cytoskeletal proteins tubulin and actin, which are found in the cytoplasm?
A) no signal peptide
B) an amino terminal signal peptide
C) an internal signal peptide
D) a signal anchor peptide

 

 

145. During the translation of mRNA molecules, the new polypeptides are often directed to specific parts of the cell by the presence or absence of short sequences of amino acids called signal peptides. Which of the following would you expect to find in the polypeptide that will eventually fold to become RNA polymerase?
A) no signal peptide
B) an amino terminal signal peptide
C) an internal signal peptide
D) a signal anchor peptide

 

 

146. During the translation of mRNA molecules, the new polypeptides are often directed to specific parts of the cell by the presence or absence of short sequences of amino acids called signal peptides. Which of the following would you expect to find in the polypeptides that will eventually fold to become enzymes important in the citric acid cycle, such as the enzyme citrate synthase, which makes citric acid?
A) no signal peptide
B) an amino terminal signal peptide
C) an internal signal peptide
D) a signal anchor peptide

 

 

147. During the translation of mRNA molecules, the new polypeptides are often directed to specific parts of the cell by the presence or absence of short sequences of amino acids called signal peptides. Which of the following would you expect to find in the polypeptide that will eventually fold to become a receptor protein?
A) no signal peptide
B) an amino terminal signal peptide
C) an internal signal peptide
D) a signal anchor peptide

 

 

148. The process of a vesicle fusing with the plasma membrane and depositing its contents into the extracellular space is referred to as:
A) active transport.
B) endocytosis.
C) budding.
D) exocytosis.
E) bridging.

 

 

149. In which of the following regions of the cell can protein synthesis occur in eukaryotes? (Select all that apply.)
A) cytoplasm
B) rough endoplasmic reticulum
C) nucleus
D) Golgi apparatus
E) lysosomes

 

 

150. The Golgi apparatus is responsible for at least a portion of a eukaryote’s:  (Select all that apply.)
A) carbohydrate synthesis.
B) modification of lipids synthesized in the ER.
C) targeting of proteins to their final destinations.
D) modification of proteins synthesized in the ER.

 

 

151. Which of the following is part of the endomembrane system of a eukaryotic cell?
A) nuclear envelope
B) the Golgi apparatus
C) vesicles
D) All of these choices are correct.

 

 

152. The controlled release of cellular material stored in membrane-bound vesicles to the outside of the cell is an example of:
A) exocytosis.
B) endocytosis.
C) transcytosis.
D) phagocytosis.

 

 

153. Where are ribosomes found inside a cell?
A) attached to the Golgi apparatus
B) in the cytosol
C) attached to the rough endoplasmic reticulum
D) both in the cytosol and attached to the rough endoplasmic reticulum

 

 

154. What is glycosylation?
A) the destruction of proteins in the lysosome
B) the process of vesicle transport between the cisternae of the Golgi apparatus
C) the addition of sugars to lipids or proteins
D) the attachment of an SRP to the signal sequence

 

 

155. A lysosomal enzyme works best at a pH of:
A) 3.
B) 5.
C) 7.
D) 8.

 

 

156. Where is the SRP receptor located in a cell?
A) in the membrane of the rough endoplasmic reticulum
B) in the membrane of the Golgi apparatus
C) in the nuclear envelope
D) in the membrane of the lysosome

 

 

157. A nuclear pore is MOST similar to a:
A) pump protein.
B) channel protein.
C) carrier protein.
D) symporter protein.

 

 

158. Which of the following would NOT be synthesized on the endoplasmic reticulum?
A) cytoskeletal proteins
B) lipids
C) pump proteins
D) lysosomal proteins

 

 

159. Where are lysosomal enzymes synthesized?
A) on the rough endoplasmic reticulum
B) in the cytosol
C) on the Golgi apparatus
D) in a vesicle

 

 

160. A proton pump is needed in the lysosomal membrane because:
A) the interior of the lysosome needs to be acidic.
B) protons are being moved from low to high concentration.
C) protons cannot move across a membrane on their own.
D) All of these choices are correct.

 

 

161. MOST proteins containing a signal sequence located at their amino terminal ends are sorted to:
A) the cytosol.
B) the nucleus.
C) a mitochondrion or the rough endoplasmic reticulum.

 

 

162. Which of the following is NOT a function of the signal recognition particle (SRP)?
A) halts translation
B) binds to the ribosome
C) binds to a channel in the rough endoplasmic reticulum
D) targets certain proteins to be synthesized on the rough endoplasmic reticulum

 

 

163. A vesicle is most similar to a:
A) micelle.
B) lipid raft.
C) liposome.
D) bilayer.

 

 

164. What accounts for the ability of vesicles to fuse with different membrane compartments in the cell?
A) the cell’s cytoskeleton
B) the fluid nature of the phospholipid bilayer
C) peripheral membrane proteins
D) transport proteins

 

 

165. Imagine you have radioactively labeled a protein in the lumen of the endoplasmic reticulum. Where would you predict the labeled protein will end up?
A) in the lumen of the Golgi apparatus
B) in the lumen of a vesicle
C) outside the cell
D) All of these choices are correct.

 

 

166. Enzymes present in the lumen of the Golgi apparatus are responsible for modifying proteins and lipids. What is the likely origin of these enzymes?
A) free ribosomes
B) the rough endoplasmic reticulum
C) the smooth endoplasmic reticulum
D) the cytosol

 

 

167. Synthesis of a protein destined to function in the nucleus occurs:
A) in the cytosol.
B) on the rough endoplasmic reticulum.
C) on the outer leaf of the nuclear envelope.
D) in the Golgi apparatus.

 

 

168. Transmembrane proteins MUST have:
A) a signal sequence.
B) a signal-anchor sequence.
C) a nuclear localization sequence.
D) both a signal sequence and a signal-anchor sequence.

 

 

  1. Kangaroo rats live in the desert of the southwestern United States. They have many adaptations to minimize water loss. They obtain a small amount of water from seeds that they eat. However, the rest of the water they obtain is from cellular respiration.
  2. A) This cannot be true, as cellular respiration doesn’t really “produce” water.
  3. B) This cannot be true, as water is actually consumed in cellular respiration.
  4. C) This could be true, as water is produced in cellular respiration.
  5. D) This could be true, as water is produced in glycolysis.
  6. E) This could be true, as water is produced in the citric acid cycle.

 

 

  1. When carbohydrates are oxidized, the C–H bonds of the carbohydrate become C=O bonds of carbon dioxide. Oxidation is defined as a loss of electrons, but carbon does not become positively charged in the process. Why then is this considered oxidation?
  2. A) The shared electrons in C–O bonds spend less time close to the carbon nucleus than the shared electrons in C–H bonds.
  3. B) Electrons in the C=O bonds are higher energy than the electrons in the C–H bonds.
  4. C) C=O bonds in CO2 are double bonds, and C–H bonds are single bonds.
  5. D) The phosphate groups of ATP are ionized, and carbons donate those electrons.

 

 

  1. Which of the following is/are TRUE regarding redox reactions? (Select all that apply.)
  2. A) Oxidizing agents accept electrons.
  3. B) If a molecule accepts electrons, it has been reduced.
  4. C) Redox reactions may involve the transfer of hydrogen ions (H+).
  5. D) A molecule that has gained H atoms is said to be reduced.
  6. E) Reducing agents accept H atoms.
  7. F) Oxidizing agents accept H+ ions.

 

 

  1. Cellular respiration releases energy. In cellular respiration:
  2. A) organic molecules such as carbohydrates are converted to chemical energy that can be used to do the work of the cell.
  3. B) the chemical potential energy stored in organic molecules is converted to chemical energy that can be used to do the work of the cell.
  4. C) chemical potential energy in the bonds of ADP is transferred to the chemical potential energy in the bonds of ATP.

 

 

  1. An organism that carries out cellular respiration in its mitochondria:
  2. A) may be a cell from a terrestrial (land) plant.
  3. B) may be a prokaryotic cell from the domain Archaea.
  4. C) is a bacterium.
  5. D) may be any kind of cell.

 

 

  1. In the reactions of glycolysis, pyruvate oxidation, and the citric acid cycle, chemical energy is transferred to the bonds in: (Select all that apply.)
  2. A)
  3. B) electron carriers.
  4. C)
  5. D) All of these choices are correct.

 

 

  1. Complete oxidation of glucose to CO2 involves two different mechanisms for synthesizing ATP: oxidative phosphorylation and substrate-level phosphorylation. Which is TRUE of substrate-level phosphorylation?
  2. A) An enzyme catalyzes the transfer of a phosphate group to ADP from an organic molecule to form ATP.
  3. B) Most of the ATP generated in cellular respiration is generated by substrate-level phosphorylation.
  4. C) ATP is generated indirectly through the transfer of high-energy electrons from electron carriers to an electron transport chain.
  5. D) ATP is generated by release of energy from the electron carriers NADH and FADH2.

 

 

  1. The energy in organic molecules is released in a series of steps because:
  2. A) it is not possible to release it in a single step.
  3. B) more total energy is released in multiple steps than would be released in a single step.
  4. C) less total energy is released in multiple steps than would be released in a single step.
  5. D) more energy can be harvested for cellular use in multiple steps than from a single step.
  6. E) only a single electron can be moved at a time in a cellular reaction.

 

 

  1. Some tissue types like brain tissue use glucose exclusively as an energy source.
  2. A) True
  3. B) False

 

 

  1. The approximate yield of ATP molecules from the full oxidation of a molecule of glucose is:
  2. A)
  3. B)
  4. C)
  5. D)
  6. E)

 

 

  1. Consulting Figure 7.3 if necessary, during which stage(s) of cellular respiration is carbon dioxide released?

 

  1. A) stage 1 only
  2. B) stages 1 and 2
  3. C) stages 2 and 3
  4. D) stage 3 only
  5. E) stages 3 and 4

 

 

  1. In which form are electrons transferred during typical redox reactions such as the oxidation of glucose?
  2. A) as free electrons
  3. B) as hydrogen atoms
  4. C) as oxygen atoms
  5. D) as carbon atoms
  6. E) as phosphate groups

 

 

  1. Which of the following molecules has the GREATEST potential energy?
  2. A) glucose
  3. B) water
  4. C) carbon dioxide

 

 

  1. The rate of cellular respiration is constant in plants and animals, including humans.
  2. A) True
  3. B) False

 

 

  1. Which is NOT a stage of cellular respiration?
  2. A) citric acid cycle
  3. B) glycolysis
  4. C) oxidative phosphorylation
  5. D) photosynthesis

 

 

  1. Are electrons lost or gained in reduction?
  2. A) lost
  3. B) gained

 

 

  1. Why do marathon runners “carbo load” (that is, eat a lot of pasta) before a big race?
  2. A) They will feel full longer.
  3. B) The bonds in carbohydrates have high potential energy.
  4. C) The bonds in carbohydrates have low potential energy and can thus be broken down and readily consumed.
  5. D) Through the process of anabolism, the athlete will break down the carbohydrates into smaller components, including ATP.

 

 

  1. Energy can be extracted from glucose and converted to ATP only if: (Select all that apply.)
  2. A) oxygen is the electron acceptor.
  3. B) the cell has mitochondria.
  4. C) the cell has membrane proteins that can pump hydrogen ions.
  5. D) the cell has enzymes that can carry out oxidation-reduction reactions.
  6. E) the cell has enzymes that can carry out glycolysis.

 

 

  1. Which one of the following represents the REDUCED forms of the two major electron carriers?
  2. A) NAD+ and FAD
  3. B) NAD+ and FADH2
  4. C) NADH and FAD
  5. D) NADH and FADH2

 

 

  1. The MOST stablethat is, least reactiveform of carbon is:
  2. A)
  3. B)
  4. C)
  5. D)
  6. E) carbon dioxide.

 

 

  1. Which one of the following is NOT a product of cellular respiration?
  2. A) carbon dioxide
  3. B) water
  4. C) oxygen
  5. D) ATP
  6. E) All of these choices are correct.

 

 

  1. The loss of electrons is referred to as _____.

 

 

  1. The gain of electrons is referred to as _____.

 

 

  1. Cellular respiration is a series of _____ reactions.
  2. A) catabolic
  3. B) anabolic
  4. C) glycolytic
  5. D) phosphorylation
  6. E) carboxylation

 

 

  1. The electron transport chain is part of:
  2. A)
  3. B) the citric acid cycle.
  4. C) oxidative phosphorylation.
  5. D)
  6. E) pyruvate oxidation.

 

 

  1. Which BEST describes energy production during cellular respiration?
  2. A) A small amount of energy is produced by substrate-level phosphorylation; most is produced by oxidative phosphorylation.
  3. B) A small amount of energy is produced by oxidative phosphorylation; most is produced by substrate-level phosphorylation.
  4. C) An equal amount is produced by oxidative phosphorylation and substrate-level phosphorylation.
  5. D) It depends on the organism. Some produce most of their energy by substrate-level phosphorylation, and some produce most of their energy by oxidative phosphorylation.
  6. E) None of the other answer options is correct.

 

 

  1. In the first three stages of cellular respiration, the chemical energy in glucose is transferred to:
  2. A) ATP and cytochrome b.
  3. B) electron carriers and ATP.
  4. C) cytochrome b and coenzyme Q.
  5. D) proton pumps and ATP.
  6. E) only coenzyme Q.

 

 

  1. Oxidation is the gain of electrons.
  2. A) True
  3. B) False

 

 

  1. The _____ forms of the electron carriers NAD+/NADH and FADH/FADH2 have high potential energy.
  2. A) oxidized
  3. B) reduced
  4. C) phosphorylated
  5. D) carboxylated
  6. E) None of the other answer options is correct.

 

 

  1. In cellular respiration, oxygen:
  2. A) gains electrons and is an oxidizing agent.
  3. B) loses electrons and is a reducing agent.
  4. C) gains electrons and is a reducing agent.
  5. D) loses electrons and is an oxidizing agent.
  6. E) None of the other answer options is correct.

 

 

  1. In cellular respiration, glucose is _____ to CO2 and oxygen is _____ to water.
  2. A) oxidized; reduced
  3. B) reduced; oxidized
  4. C) deoxygenated; phosphorylated
  5. D) phosphorylated; deoxygenated
  6. E) oxidized; oxidized

 

 

  1. The chemical bonds of carbohydrates and lipids have high potential energy because:
  2. A) they are strong oxidizing agents.
  3. B) they are strong reducing agents.
  4. C) many of these bonds are C—C and C—H bonds.
  5. D) they are easy to phosphorylate.
  6. E) they are easy to hydrolyze.

 

 

  1. In a plant cell, all stages of cellular respiration are carried out in the cytoplasm.
  2. A) True
  3. B) False

 

 

  1. Which of the following statements is TRUE regarding aerobic respiration?
  2. A) Aerobic respiration requires oxygen at every stage of the process.
  3. B) Aerobic respiration is carried out by all prokaryotes and eukaryotes.
  4. C) Aerobic respiration is a three-stage process, with oxidative phosphorylation comprising the last stage.
  5. D) Carbon dioxide is produced at every stage of aerobic respiration.
  6. E) None of the other answer options is correct.

 

 

  1. Which of the following statements is TRUE regarding the equation C6H12O6 + 6O2  6CO2 + 6H2O + energy?
  2. A) The oxygen atoms in both CO2 and H2O are electronegative.
  3. B) In the production of CO2 from glucose, the oxygen atoms lose electrons and the carbon atom is oxidized.
  4. C) Glucose could be considered a reducing agent.
  5. D) The movement of hydrogen atoms in reactions involving C6H12O6 and H2O yields no information regarding the movement of electrons.
  6. E) The oxygen atoms in both CO2 and H2O are electronegative, and glucose is considered a reducing agent.

 

 

  1. Which of the following statements is TREUE regarding a reducing agent?
  2. A) It loses electrons.
  3. B) It gains electrons.
  4. C) It is an electron acceptor.
  5. D) It is usually oxygen.
  6. E) It is never oxidized.

 

 

  1. When glucose is broken down in a cell, all of the energy it stores is released simultaneously, not in a stepwise process.
  2. A) True
  3. B) False

 

 

  1. Which stage of cellular respiration occurs immediately after pyruvate is produced?
  2. A) glycolysis
  3. B) pyruvate oxidation
  4. C) citric acid cycle
  5. D) electron transport
  6. E) oxidative phosphorylation

 

 

  1. A molecule that is _____ loses electrons, and a molecule that is _____ gains electrons.
  2. A) reduced; oxidized
  3. B) negative; positive
  4. C) oxidized; reduced
  5. D) weak; polar
  6. E) None of the other answer options is correct.

 

 

  1. Glycolysis is a series of chemical reactions (endergonic and exergonic) by which the cell can obtain ATP. NAD+ plays a crucial role in the reactions of glycolysis by:
  2. A) accepting electrons from glucose, with the result that glucose is partially oxidized to pyruvate.
  3. B) donating electrons to pyruvate when glucose becomes partially oxidized.
  4. C) converting endergonic reactions to exergonic reactions so that there is an output of energy to make ATP.
  5. D) donating electrons to ADP to make ATP.

 

 

  1. You are trying to find the maximum source of energy for an organism. Which of the following compounds would you choose?
  2. A) glucose
  3. B) oxygen
  4. C) ATP
  5. D) pyruvate
  6. E) NADH

 

 

  1. The phosphorylation of glucose during glycolysis serves to: (Select all that apply.)
  2. A) destabilize the molecule, making it easier to cleave.
  3. B) trap imported glucose inside the cell.
  4. C) reduce an electron carrier, storing energy for later.

 

 

  1. How many reactions in glycolysis directly generate ATP?
  2. A) 1
  3. B) 2
  4. C) 3
  5. D) 4
  6. E) 5

 

 

  1. Glycolysis results in the partial oxidation of glucose to pyruvate. This means that:
  2. A) glucose combines with oxygen in the cytoplasm to get partially oxidized.
  3. B) glucose is broken down partially to ATP in the cytoplasm.
  4. C) glucose donates electrons directly to NAD+.
  5. D) glycolysis consists only of exergonic reactions so that ATP can be made from the release of energy.
  6. E) the electron carriers donate electrons to proteins in the mitochondria that in turn produce ATP.
  7. F) in the process of the conversion of glucose to pyruvate, some potential energy is transferred to NADH and ATP.

 

 

  1. Even though the full oxidation of glucose is exergonic, some of the reactions in cellular respiration are endergonic.
  2. A) True
  3. B) False

 

 

  1. In eukaryotic cells, glycolysis occurs in:
  2. A) the cytoplasm.
  3. B) the nucleus.
  4. C) the matrix of the mitochondria.
  5. D) the endoplasmic reticulum.
  6. E)

 

 

  1. Which of the following is a net product of glycolysis? (Select all that apply.)
  2. A) 2 pyruvate
  3. B) 2 ATP
  4. C) 2 NADH

 

 

  1. Glycolysis is:
  2. A)
  3. B)
  4. C) aerobic in some organisms but anaerobic in others.
  5. D) aerobic in some tissues but anaerobic in others.
  6. E) None of the other answer options is correct.

 

 

  1. Which of the following is NOT one of the net final products of glycolysis?
  2. A) two molecules of pyruvate
  3. B) two molecules of ATP
  4. C) two molecules of NADH
  5. D) two molecules of acetyl-CoA

 

 

  1. In glycolysis, ATP is synthesized by:
  2. A) substrate-level phosphorylation.
  3. B) oxidative phosphorylation.
  4. C) both substrate level and oxidative phosphorylation.
  5. D) electron carriers.
  6. E) redox reactions.

 

 

  1. The first phase of glycolysis requires the input of two ATP molecules. It is therefore:
  2. A)
  3. B)
  4. C)
  5. D)
  6. E) None of the other answer options is correct.

 

 

  1. Which of the following does NOT occur during the third phase of glycolysis?
  2. A) pyruvate production
  3. B) ATP synthesis
  4. C) the transfer of high-energy electrons to NAD+
  5. D) oxygen consumption
  6. E) None of the other answer options is correct.

 

 

  1. At the end of glycolysis, the carbon molecules originally found in the starting glucose molecule are in the form of:
  2. A) one pyruvate molecule.
  3. B) two pyruvate molecules.
  4. C) two ATP molecules.
  5. D) two NADH molecules.
  6. E) four ATP molecules.

 

 

  1. Phosphorylating glucose during phase 1 of glycolysis:
  2. A) releases phosphorylated glucose from cells.
  3. B) destabilizes the glucose molecule so that it can be broken down in phase 2.
  4. C) provides electrons to reduce NAD+ in phase 3.
  5. D) provides electrons to reduce FADH in phase 3.
  6. E) None of the other answer options is correct.

 

 

  1. In the second phase of glycolysis:
  2. A) phosphate groups are added to glucose.
  3. B) phosphorylated sugar molecule is cleaved and the products rearranged.
  4. C) ATP is generated by substrate-level phosphorylation.
  5. D) NAD+ is reduced to NADH.
  6. E) ATP is generated by oxidative phosphorylation.

 

 

  1. The inputs to glycolysis do NOT include: (Select all that apply.)
  2. A)
  3. B) NAD+.
  4. C)
  5. D)
  6. E)

 

 

  1. The ATP produced during glycolysis is the result of substrate-level phosphorylation.
  2. A) True
  3. B) False

 

 

  1. During what phase of glycolysis is NADH formed?
  2. A) during phase 1, when fructose 1,6-biphosphate is formed
  3. B) during phase 2, when glyceraldehyde 3-phosphate is formed
  4. C) during phase 3, when glyceraldehyde 3-phosphate is phosphorylated
  5. D) during phase 3, when pyruvate is finally formed
  6. E) during phase 1, when glucose is phosphorylated

 

 

  1. Imagine that a eukaryotic cell carries a mutation impairing its ability to phosphorylate glucose during glycolysis. What is a likely result of this mutation?
  2. A) High (possibly toxic) levels of glucose would accumulate in the cell.
  3. B) Glucose could move out of the cell, slowing cellular respiration.
  4. C) Because phosphorylation stabilizes glucose, glucose would spontaneously form pyruvate.
  5. D) Without the phosphorylation of glucose, glycolysis would consist entirely of exergonic reactions.
  6. E) More pyruvate would be formed at the end of glycolysis.

 

 

  1. Although cellular respiration is typically thought of as an aerobic process, glycolysis itself is actually anaerobic.
  2. A) True
  3. B) False

 

 

  1. Although glycolysis produces four molecules of ATP by substrate-level phosphorylation, the net gain of ATP for the cell is two molecules. This is due to the fact that glycolysis is—at first—endergonic.
  2. A) True
  3. B) False

 

 

  1. How did the earliest organisms on Earth most likely produce ATP?
  2. A) by pyruvate oxidation
  3. B) by glycolysis
  4. C) by the citric acid cycle
  5. D) by oxidative phosphorylation

 

 

  1. The reaction diagrammed here: (Select all that apply.)

 

  1. A) is the final reaction of glycolysis.
  2. B) is one possible pathway in the fermentation of pyruvate.
  3. C) shows synthesis of the substrate that enters the citric acid cycle.
  4. D) occurs in the cytosol.
  5. E) occurs in the mitochondrial matrix.
  6. F) occurs twice for each glucose oxidized.

 

 

  1. What is the relationship between the reaction diagrammed here and glycolysis?

 

 

 

  1. What is the relationship between the reaction diagrammed below and the citric acid cycle?

 

 

 

  1. In eukaryotic cells, the oxidation of pyruvate occurs in:
  2. A) the cytoplasm.
  3. B) the nucleus.
  4. C) the matrix of the mitochondria.
  5. D) the endoplasmic reticulum.
  6. E)

 

 

  1. What glycolysis product is transported into the mitochondria?
  2. A) ATP
  3. B) NADP
  4. C) pyruvate
  5. D) glucose

 

 

  1. In the reaction in the diagram below, pyruvate is converted to acetyl-CoA. Which if any of the following statements concerning this reaction is TRUE? (Select all that apply.)

 

 

  1. A) CO2 is the most oxidized and therefore least energetic form of carbon.
  2. B) NAD+ is more reduced than NADH.
  3. C) NAD+ is an oxidizing agent.
  4. D) This is not an oxidation/reduction reaction; that is, no electrons have moved.
  5. E) This reaction harnesses the last of the remaining potential energy from glucose.

 

 

  1. The conversion of pyruvate to acetyl-CoA does not produce any ATP directly. However, it does contribute to ATP production indirectly. How?

 

 

  1. In eukaryotes, pyruvate oxidation takes place in the:
  2. A)
  3. B) outer mitochondrial membrane.
  4. C) inner mitochondrial membrane.
  5. D) intermembrane space of mitochondria.
  6. E) mitochondrial matrix.

 

 

  1. Pyruvate oxidation is an important stage in cellular respiration because it:
  2. A) generates ATP by substrate-level phosphorylation.
  3. B) transfers large numbers of electrons to electron carriers.
  4. C) links glycolysis with the citric acid cycle.
  5. D) eliminates toxic pyruvate from the cell.
  6. E) is the first step in oxidative phosphorylation.

 

 

  1. When a single pyruvate is converted to acetyl-CoA, the other products of the reaction are:
  2. A) CO2 and ATP.
  3. B) NADH and CO2.
  4. C) ATP and NADH.
  5. D) Pi and FADH2.
  6. E) FADH2 and ATP.

 

 

  1. Another name for acetyl-CoA synthesis is:
  2. A)
  3. B) pyruvate oxidation.
  4. C) oxidative phosphorylation.
  5. D) substrate-level phosphorylation.
  6. E) pyruvate reduction.

 

 

  1. During pyruvate oxidation, pyruvate is broken down into CO2 and an acetyl group. The CO2 is _____ than the acetyl group.
  2. A) less oxidized
  3. B) more reduced
  4. C) more energetic
  5. D) less energetic
  6. E) None of the other answer options is correct.

 

 

  1. After pyruvate oxidation, the chemical energy of how many carbons of the original glucose molecule is converted to chemical energy in the form of ATP in the remaining steps of cellular respiration?
  2. A) 1
  3. B) 2
  4. C) 3
  5. D) 4
  6. E) 5

 

 

  1. By the time pyruvate is formed, most of the energy contained in glucose has been released.
  2. A) True
  3. B) False

 

 

  1. Which of the following statements is TRUE regarding pyruvate oxidation?
  2. A) Like glycolysis, pyruvate oxidation is carried out in the mitochondria.
  3. B) Pyruvate oxidation ends with the oxidation of an acetyl group, which forms CO2.
  4. C) Pyruvate oxidation forms the same number of NADH (per glucose molecule) as glycolysis.
  5. D) Pyruvate oxidation directly follows the citric acid cycle during cellular respiration.

 

 

  1. During pyruvate oxidation, which of the following also occur(s)?
  2. A) the formation of NADH
  3. B) the oxidation of pyruvate
  4. C) the formation of acetyl-CoA
  5. D) the formation of CO2
  6. E) All of these choices are correct.

 

 

  1. Which of the following statements is TRUE regarding pyruvate and glucose?
  2. A) Glucose easily passes in and out of mitochondria, and can often be found in the mitochondrial matrix.
  3. B) Pyruvate is typically “trapped” in the intermembrane space of mitochondria, where it is oxidized to form acetyl-CoA.
  4. C) Glucose and pyruvate are remarkably similar in structure, with both molecules possessing a ring shape.
  5. D) Both glucose and pyruvate can feed directly into the citric acid cycle, although acetyl-CoA is the preferred reactant for this process.
  6. E) None of the other answer options is correct.

 

 

  1. Pyruvate oxidation produces a large amount of ATP.
  2. A) True
  3. B) False

 

 

  1. In what organelle is pyruvate oxidation carried out in a cell?
  2. A) chloroplast
  3. B) nucleus
  4. C) mitochondrion
  5. D) Golgi apparatus
  6. E) endoplasmic reticulum

 

 

  1. Pyruvate oxidation is remarkably similar to glycolysis in that when one molecule of pyruvate enters into a mitochondrion, two molecules of acetyl-CoA are formed.
  2. A) True
  3. B) False

 

 

  1. Like glycolysis, pyruvate oxidation produces both pyruvate and acetyl-CoA. These two products feed directly into the citric acid cycle and are the reactants for the cycle.
  2. A) True
  3. B) False

 

 

  1. Which of the following statements is true regarding pyruvate oxidation?
  2. A) This process occurs within the matrix of mitochondria.
  3. B) This process constitutes the second stage of cellular respiration.
  4. C) The process produces both CO2 and acetyl-CoA.
  5. D) The process yields no ATP via substrate-level phosphorylation.
  6. E) All of these choices are correct.

 

 

  1. In step 6 of the citric acid cycle, succinate + FAD  fumarate + FADH2. Which statement concerning this reaction is/are TRUE?  (Select all that apply.)
  2. A) Fumarate is more oxidized than succinate.
  3. B) FAD is more reduced than FADH2.
  4. C) FAD is an oxidizing agent in the reaction.
  5. D) This is not an oxidation/reduction reaction; that is, no electrons have moved.
  6. E) None of the other answer options is correct.

 

 

  1. Following the citric acid cycle but before the electron transport chain and oxidative phosphorylation, most of the energy from the original glucose molecule is found in:
  2. A) acetyl-CoA.
  3. B)
  4. C)
  5. D)
  6. E)

 

 

  1. Following the citric acid cycle but before the electron transport chain and oxidative phosphorylation, how much potential energy has been transferred to the bonds of ATP (at 7.3 kcal/mol)? the bonds of NADH (at 53 kcal/mol)? If glucose oxidation to CO2 and H2O has a G of 676 kcal/mol, what proportion of potential energy has been captured? Where would you predict the remaining potential energy has gone?

 

 

  1. Each round of the citric acid cycle begins when the four-carbon molecule oxaloacetate is converted to the six-carbon molecule citrate. As the cycle progresses, two carbons are eliminated to regenerate the oxaloacetate. The added carbon is supplied by _____ and the two eliminated carbons are released as _____.
  2. A) ATP; acetyl-CoA
  3. B) CO2; pyruvate
  4. C) acetyl-CoA; CO2
  5. D) CO2; NADH
  6. E) CO2; acetyl-CoA

 

 

  1. Complete oxidation of glucose to CO2 involves two different mechanisms for synthesizing ATP: oxidative phosphorylation and substrate-level phosphorylation. Substrate-level phosphorylation: (Select all that apply.)
  2. A) requires activity of the enzyme ATP synthase.
  3. B) occurs in the mitochondria.
  4. C) occurs across the inner mitochondrial membrane.
  5. D) requires an electron transport chain.
  6. E) occurs in the cytosol.

 

 

  1. In 1937, two German biochemists published a paper proposing the following reactions as part of glucose oxidation:

citrate  isocitrate  -ketoglutarate  succinate  fumarate  malate   oxaloacetate

 

Adding succinate, fumarate, or malate to thin slices of tissue increased oxygen consumption, supporting the hypothesis that these molecules are intermediates in the process. However, a puzzling observation was that intermediates were still present in the reaction mixture at the end of the experiment. If they are intermediates, then they should be consumed as the next product in the pathway is formed. What explains this observation?

  1. A) Succinate, fumarate, and malate are not reactants but catalysts, and catalysts are not consumed in the process.
  2. B) Succinate, fumarate, and malate are constantly regenerated in the citric acid pathway.
  3. C) Succinate, fumarate, and malate increase metabolism and therefore oxygen consumption, but they are not directly part of the glucose oxidation pathway.

 

 

  1. Pyruvate can be used to produce: (Select all that apply.)
  2. A)
  3. B) acetyl-CoA.
  4. C)

 

 

  1. Acetate is the starting point for synthesis of a cell’s _____.

 

 

  1. The citric acid cycle begins when acetyl-CoA combines with _____ to form _____.
  2. A) pyruvate; citrate
  3. B) malate; oxaloacetate
  4. C) oxaloacetate; malate
  5. D) oxaloacetate; citrate
  6. E) citrate; cis-aconitate

 

 

  1. Which of the following is a net product of the citric acid cycle for each molecule of pyruvate generated in glycolysis? (Select all that apply.)
  2. A) 1 ATP
  3. B) 3 NADH
  4. C) 1 FADH2

 

 

  1. Which of the following molecules has the GREATEST potential energy?
  2. A) ATP
  3. B) NADH
  4. C) NAD+
  5. D) FAD
  6. E) FADH2

 

 

  1. Order the following list of molecules according to their potential energy from high to low.
  2. ATP
  3. NADH
  4. NAD+
  5. FADH2

 

 

  1. If an energy source such as sunlight is available, the citric acid cycle can run in reverse in some organisms.
  2. A) True
  3. B) False

 

 

  1. In which stage of cellular respiration is the greatest amount of chemical energy harvested from molecules that are derived from food?
  2. A) glycolysis
  3. B) the conversion of pyruvate to acetyl-CoA
  4. C) the citric acid cycle
  5. D) the electron-transport chain

 

 

  1. The citric acid cycle is believed to have developed fairly recently in the evolution of cellular life.
  2. A) True
  3. B) False

 

 

  1. During the citric acid cycle:
  2. A) fuel molecules are completely reduced.
  3. B) ATP is synthesized by substrate-level phosphorylation.
  4. C) high-energy electrons are removed from NAD+ and FADH.
  5. D) ATP is synthesized by oxidative phosphorylation.

 

 

  1. The citric acid cycle takes place in the:
  2. A)
  3. B) outer mitochondrial membrane.
  4. C) inner mitochondrial membrane.
  5. D) intermembrane space of mitochondria.
  6. E) mitochondrial matrix.

 

 

  1. The majority of the energy generated in the citric acid cycle is in the form of:
  2. A) ATP produced by substrate-level phosphorylation.
  3. B) GTP produced by substrate-level phosphorylation.
  4. C) electrons donated to NAD+ and FAD+.
  5. D) ATP produced by oxidative phosphorylation.
  6. E) GTP produced by oxidative phosphorylation.

 

 

  1. The citric acid cycle is a cycle because the starting molecule, _____, is regenerated at the end.
  2. A) acetyl-CoA
  3. B) oxaloacetate
  4. C) fructose 6-diphosphate
  5. D) pyruvate
  6. E) citrate

 

 

  1. Which of the following is NOT an end product for an acetyl group that enters the citric acid cycle?
  2. A) ATP
  3. B) NADH
  4. C) FADH2
  5. D) CO2
  6. E) oxaloacetate

 

 

  1. A single molecule of glucose requires _____ “turn(s)” through the citric acid cycle for its chemical energy to be completely harvested.
  2. A) 1
  3. B) 2
  4. C) 3
  5. D) 4
  6. E) 5

 

 

  1. ATP is not generated directly in the citric acid cycle; instead, an intermediate is first generated by substrate-level phosphorylation. The intermediate is:
  2. A) acetyl-CoA.
  3. B)
  4. C)
  5. D)
  6. E)

 

 

  1. During the citric acid cycle, the production of CO2 is the result of the _____ of intermediate compounds of the citric acid cycle coupled to the production of _____.
  2. A) oxidation; NADH
  3. B) oxidation; ATP
  4. C) reduction; NADH
  5. D) reduction; ATP
  6. E) oxidation; GTP

 

 

  1. Once they have been processed through the citric acid cycle, the acetyl-CoA molecules from a single glucose molecule produce:
  2. A) 2 ATP, 6 NADH, 4 CO2.
  3. B) 6 NADH, 6 GTP.
  4. C) 6 FADH2, 2 ATP, 6 CO2.
  5. D) 6 GTP, 6 FADH2.
  6. E) 4 CO2, 6 FADH2, 2 ATP.

 

 

  1. Malate is both the starting and ending product of the citric acid cycle.
  2. A) True
  3. B) False

 

 

  1. Which is the ONLY reaction in the citric acid cycle that produces ATP by substrate-level phosphorylation?
  2. A) the formation of fumarate
  3. B) the formation of malate
  4. C) the formation of citrate
  5. D) the formation of succinate
  6. E) the formation of oxaloacetate

 

 

  1. Which of the following processes produces the HIGHEST number of reduced electron carriers and thus the GREATEST amount of ATP by oxidative phosphorylation?
  2. A) the citric acid cycle
  3. B) glycolysis
  4. C) pyruvate oxidation
  5. D) glycolysis and the citric acid cycle are tied for ATP production
  6. E) None of the other answer options is correct.

 

 

  1. Imagine that you exhale after a deep breath. Which of the following are you NOT exhaling?
  2. A) CO2
  3. B) waste products of glycolysis
  4. C) waste products of pyruvate oxidation
  5. D) waste products of the citric acid cycle
  6. E) waste products of both pyruvate oxidation and the citric acid cycle

 

 

  1. Recall that the citric acid cycle starts with a four-carbon molecule, but that most of its intermediates are molecules that contain six carbons. How is this possible?
  2. A) through the reaction of succinate and succinyl-CoA
  3. B) through the reaction of malate and oxaloacetate
  4. C) through the reaction of acetyl-CoA and oxaloacetate
  5. D) through the reaction of malate and fumarate
  6. E) through the reaction of citrate and cis-aconitate

 

 

  1. A researcher is studying a population of bacteria that carry out the citric acid cycle, but do so in reverse. What statements are likely TRUE of these bacteria?
  2. A) An individual bacterium will produce most of its energy by means of the citric acid cycle.
  3. B) These bacteria carry out cellular respiration in their mitochondria.
  4. C) These bacteria will produce sugars from intermediates of the citric acid cycle.
  5. D) These bacteria will release CO2 as a waste product.
  6. E) These bacteria will release CO2 as a waste product and will carry out cellular respiration within their mitochondria.

 

 

  1. Atractyloside is a poison that inhibits the transport of ADP from the cytosol across the mitochondrial membranes and into the mitochondrial matrix. The direct effect of this drug is to stop ATP synthesis because:
  2. A) ADP is a necessary substrate for the reaction catalyzed by ATP synthase.
  3. B) it prevents proton pumping across the inner mitochondrial membrane.
  4. C) it prevents electron transfer to O2.
  5. D) it prevents electron transfer from NADH to complex I.

 

 

  1. Oligomycin is an antibiotic that binds ATP synthase, blocking the flow of protons through the enzyme’s proton channel. In addition to preventing synthesis of ATP, what additional effect might you expect in response to the presence of oligomycin?
  2. A) higher pH in the intermembrane space
  3. B) lower pH in the intermembrane space
  4. C) a buildup of protons in the mitochondrial matrix

 

 

  1. Very low concentrations of detergent make membranes leaky to small molecules and ions without damaging proteins. In isolated mitochondria exposed to detergent, the molecules of the electron transport chain and of ATP synthase remain intact. Do you expect ATP synthesis to continue in the presence of low concentrations of detergent?
  2. A) Yes, because all enzymes and electron carriers are functional.
  3. B) No, because with a leaky membrane, the proton gradient cannot be maintained.
  4. C) No, because leaky membranes do not allow NADH and FADH2 to donate their electrons to the electron transport chain.
  5. D) No, because leaky membranes inhibit glycolysis.

 

 

  1. The pH in the intermembrane space of the mitochondria should be _____ compared with the matrix due to the concentration of protons in the intermembrane space.
  2. A) lower; higher
  3. B) higher; higher
  4. C) higher; lower
  5. D) lower; lower

 

 

  1. Brown fat is a specialized tissue found in infants and hibernating mammals. Brown fat mitochondria have proton channels located in their inner membranes. What does this mean for the organism?
  2. A) ATP production would be reduced because these organisms do not need as much energy.
  3. B) Channels would contribute to the formation of the proton electrochemical gradient.
  4. C) The potential energy of the proton electrochemical gradient would be released as heat.
  5. D) There would be no effect.

 

 

  1. A research group has discovered an organism with cells that contain a previously undescribed organelle. They do some tests on the isolated organelle to see if it is involved in any major metabolic reactions. To do this, they incubate these organelles for a period of time and determine changes in the amount of various substances in the suspending solution. The results follow.

 

 

 

Based on this analysis, which metabolic process do you conclude is taking place in this organelle?

  1. A) pyruvate oxidation
  2. B) citric acid cycle
  3. C) glycolysis
  4. D) electron transport chain/oxidative phosphorylation
  5. E) glycolysis and the citric acid cycle

 

 

  1. A research group has discovered an organism with cells that contain a previously undescribed organelle. They do some tests on the isolated organelle to see if it is involved in any major metabolic reactions. To do this, they incubate these organelles for a period of time and determine changes in the amount of various substances in the suspending solution. The results follow.

 

 

 

Based on this analysis, which metabolic process do you conclude is taking place in this organelle?

  1. A) pyruvate oxidation
  2. B) citric acid cycle
  3. C) glycolysis
  4. D) electron transport chain/oxidative phosphorylation
  5. E) glycolysis and the citric acid cycle

 

 

  1. A research group has discovered an organism with cells that contain a previously undescribed organelle. They do some tests on the isolated organelle to see if it is involved in any major metabolic reactions. To do this, they incubate these organelles for a period of time and determine changes in the amount of various substances in the suspending solution. The results are:

 

 

 

Based on this analysis, which metabolic process do you conclude is taking place in this organelle?

  1. A) pyruvate oxidation
  2. B) citric acid cycle
  3. C) glycolysis
  4. D) electron transport chain/oxidative phosphorylation
  5. E) glycolysis and the citric acid cycle

 

 

  1. Which of these reactions summarizes the overall reactions of cellular respiration?
  2. A) C6H12O6 + 6 O2  6 CO2 + 6 H2O + energy
  3. B) 6 CO2 + 6 H2O + energy  C6H12O6 + 6 O2
  4. C) C6H12O6 + 6 O2 + energy  6 CO2 + 12 H2O
  5. D) 6 CO2 + 6 O2  C6H12O6 + 6 H2O
  6. E) H2O  2 H+ + 1/2 O2 + 2e-

 

 

  1. Most of the ATP produced during cellular respiration is generated through:
  2. A) substrate-level phosphorylation.
  3. B) oxidative phosphorylation.
  4. C) reduction of NAD+.
  5. D) reduction of FAD.
  6. E) oxidation of pyruvate.

 

 

  1. Certain complexes of the mitochondrial electron transport chain pump protons. Which of the following BEST describes the movement of protons in this situation?
  2. A) across the outer mitochondrial membrane, from the cytoplasm to the intermembrane space
  3. B) across the outer mitochondrial membrane, from the intermembrane space to the cytoplasm
  4. C) across the inner mitochondrial membrane, from the intermembrane space to the matrix
  5. D) across the inner mitochondrial membrane, from the matrix to the intermembrane space

 

 

  1. If oxygen is unavailable, predict what happens to the citric acid cycle.
  2. A) It stops because the supplies of NAD+ and FAD become depleted.
  3. B) It stops because ADP levels increase in the absence of oxygen.
  4. C) It continues because none of the reactions in the citric acid cycle require oxygen.
  5. D) It continues because ATP levels are low, and low ATP activates enzymes of the cycle.

 

 

  1. When oxygen is depleted, the citric acid cycle stops. Which of the following would you need to add to the system to restore activity? (Select all that apply.)
  2. A) glucose
  3. B) NAD+
  4. C) NADH
  5. D) FAD
  6. E) acetyl-CoA

 

 

  1. When oxygen is depleted, the citric acid cycle stops. What could we add to the system to restore activity (other than oxygen)?

 

 

  1. Which of the following is TRUE about ATP synthase? (Select all that apply.)
  2. A) ATP synthase is an integral membrane protein.
  3. B) ATP synthase is a transport protein.
  4. C) ATP synthase makes a total of four ATP molecules in glycolysis.
  5. D) The mRNA molecules that encode ATP synthase lack signal sequences.
  6. E) Under aerobic conditions, the F1 portion of ATP synthase catalyzes a catabolic reaction.
  7. F) ATP synthase is an important enzyme in the citric acid cycle.
  8. G) ATP synthase relies on an electrochemical gradient of sodium ions to catalyze the formation of ATP.

 

 

  1. Which one of the following does NOT actively move protons from the mitochondrial matrix to the intermembrane space?
  2. A) complex I
  3. B) complex II
  4. C) complex III
  5. D) complex IV
  6. E) None of the other answer options is correct.

 

 

  1. Which of the following is a mobile electron carrier in the electron transport chain? (Select all that apply.)
  2. A) ubiquinone
  3. B) cytochrome c
  4. C) ATP synthase

 

 

  1. What is the FINAL electron acceptor in the electron transport chain?
  2. A) glucose
  3. B) oxygen
  4. C) ATP
  5. D) ADP

 

 

  1. What would happen if complexes I–IV of the electron transport chain pumped protons in the opposite direction?
  2. A) No ATP would be synthesized.
  3. B) Too much ATP would be synthesized.
  4. C) There would be too many electrons in the mitochondrial matrix.
  5. D) None of the other answer options is correct.

 

 

  1. The Fo subunit of ATP synthase is largely:
  2. A)
  3. B)

 

 

  1. Animals breathe in air containing oxygen and breathe out air containing less oxygen. The consumed oxygen is used:
  2. A) in the citric acid cycle.
  3. B) in the glycolysis pathway.
  4. C) in the conversion of pyruvate to acetyl Co-A.
  5. D) in photosynthesis.
  6. E) as an electron acceptor in the respiratory electron transport chain.

 

 

  1. DNP (2,4-dinitrophenol) is an effective weight-loss agent that was used in diet pills in the 1930s. It has since been removed from the market (though it is available online) because of serious side effects such as fever, cataracts, rashes, and sometimes death. DNP inserts into the inner mitochondrial membrane and shuttles protons between the intermembrane space and the matrix. Based on this information, which of the following might you predict? (Select all that apply.)
  2. A) increased hydrolysis of ATP
  3. B) reduced ATP production
  4. C) dissipation of the proton gradient
  5. D) increased ATP production
  6. E) decreased difference in pH between the matrix and intermembrane space

 

 

  1. The energy from the movement of electrons through the electron transport chain is directly used to synthesize ATP.
  2. A) True
  3. B) False

 

 

  1. The catalytic subunit of an ATP synthase is referred to as the F1 subunit.
  2. A) True
  3. B) False

 

 

  1. An ATP synthase complex can act in reverse to function as an ATP-dependent proton pump.
  2. A) True
  3. B) False

 

  1. Which of the following is NOT part of the general response of cells during cellular communication?
  2. A) The cell does not return to its normal activities after the signal has exerted its effect.
  3. B) Receptors on the outside of the cell bind to specific signal molecules.
  4. C) A cell-surface receptor molecule becomes activated by binding to a molecular signal.
  5. D) An activated cell-surface receptor transfers the signal to the interior of the cell.
  6. E) The signal is transmitted inside the cell and amplified as a series of proteins are activated in sequence, affecting cellular activities according to the type of signal involved.

 

 

  1. Which of the following statements about communication among bacteria is CORRECT? (Select all that apply.)
  2. A) At low population density, a high concentration of signaling molecules involved in DNA uptake is typically observed.
  3. B) Unlike communication among eukaryotes, no receptor molecule is required in communication among bacteria.
  4. C) Small peptides can stimulate a DNA-uptake response.
  5. D) Cellular communication in bacteria is based on the same principles as communication among eukaryotic cells.

 

 

  1. List the four essential components of cell communication, and describe their functions.

 

 

  1. A protein on a cell surface that binds to a signaling molecule is an example of which of the following elements of cellular communication?
  2. A) a signaling cell
  3. B) a signaling molecule
  4. C) a receptor protein
  5. D) a responding cell
  6. E) None of the other answer options is correct.

 

 

  1. To have communication between cells, you must have a:
  2. A)
  3. B) signaling molecule.
  4. C) responding cell.
  5. D) All of these choices are correct.

 

 

  1. Which is NOT one of the steps in cell signaling?
  2. A) signal transduction
  3. B) obtaining a high density of signaling molecules
  4. C) receptor activation
  5. D) signal termination
  6. E) cellular response

 

 

  1. Choose from the following terms to fill in the blanks in the CORRECT order.
  2. ligand
  3. signaling cell
  4. receptor
  5. responding cell

 

In communication between cells, the _____ produces the signaling molecule, also known as the _____; the _____ produces the _____, to which the signaling molecule binds,

  1. A) B, A, D, C
  2. B) A, B, C, D
  3. C) B, C, A, D
  4. D) D, C, B, A

 

 

  1. Nicotine from cigarette smoke acts as a ligand and associates with specific cells in the nervous system. Nicotine eventually produces feelings of pleasure and well-being.  Below are the events that happen in the cellular response to nicotine.  Place the events in the correct order to describe the steps in the signaling pathway.
  2. The acetylcholine receptor is an ion channel, and, when a ligand binds, the ion channel opens.
  3. An influx of ions carries the signal to the reward areas of the brain.
  4. Nicotine binds to the transmembrane protein that normally binds the neurotransmitter acetylcholine.
  5. The signal causes release of dopamine in the brain, which causes good feelings.
  6. Nicotine is quickly eliminated from the body (causing cravings for more cigarettes to produce good feelings).
  7. A) C, A, B, D, E
  8. B) A, D, B, C, E
  9. C) B, A, C, D, E
  10. D) C, D, B, A, E
  11. E) Nicotine is quickly eliminated from the body (causing cravings for more cigarettes to produce good feelings).

 

 

  1. In which of the following is cell signaling prevented?
  2. A) The nicotine in cigarette smoke binds to and activates the acetylcholine receptor in plasma membranes of neurons in the brain.
  3. B) Proteins on the surface of cells in taste buds called umami receptors bind to glutamates and nucleotides in food, which changes the membrane potential of these cells and tells the brain, “This is savory.”
  4. C) Allergy medicines, which are called antihistamines, bind to and block histamine receptors to keep fluids in capillaries that would normally be released and cause stuffy noses and watery eyes.

 

 

  1. Which of the following types of cellular activities can be a response to cell signaling?
  2. A) Cell division is triggered.
  3. B) Gene expression patterns are changed.
  4. C) Enzyme activities are changed.
  5. D) Cell signals are released to communicate with other cells.
  6. E) All of these choices are correct.

 

 

  1. A cell that responds to an environmental condition by the release of a chemical is an example of which of the following elements of cellular communication?
  2. A) a signaling cell
  3. B) a signaling molecule
  4. C) a receptor protein
  5. D) a responding cell
  6. E) None of the other answer options is correct.

 

 

  1. A chemical that binds to a cell and causes its activity to change is an example of which of the following elements of cellular communication?
  2. A) a signaling cell
  3. B) a signaling molecule
  4. C) a receptor protein
  5. D) a responding cell
  6. E) None of the other answer options is correct.

 

 

  1. Signal transduction results in:
  2. A) a change in the conformation of the receptor protein.
  3. B) a response by the cell.
  4. C) production of more signal molecules.
  5. D) termination of the signal.

 

 

  1. Which is the CORRECT order for these steps in cell signaling?
  2. A) signal transduction, receptor activation, response
  3. B) response, signal transduction, termination
  4. C) receptor activation, response, signal transduction
  5. D) receptor activation, signal transduction, response

 

 

  1. Which of the following is NOT an essential element involved in communication between all cells?
  2. A) responding cell
  3. B) signaling molecule
  4. C) second messenger
  5. D) receptor protein

 

 

  1. Signaling pathways have been conserved in a wide range of organisms.
  2. A) True
  3. B) False

 

 

  1. During the signal transduction process, the signal often triggers a signal transduction cascade. For example, an activated receptor activates hundreds of protein A.  Each activated protein A activates hundreds of protein B and so on until a cellular response occurs.  What purpose does this cascade serve?
  2. A) Having several intermediates allows for greater control of the response.
  3. B) The cascade serves to amplify the signal, so one activated receptor can have a significant response.
  4. C) Having a cascade allows the cell to respond to different signals.
  5. D) The cascade makes signaling easier to shut off or terminate.

 

 

  1. In cell communication, which one of the following is a requirement of the responding cell?
  2. A) It must be a eukaryotic cell.
  3. B) It must produce signaling molecules.
  4. C) It must have receptor proteins.
  5. D) It must be a prokaryotic cell.

 

 

  1. Which of the following is a cellular response to signal transduction?
  2. A) a change in the proteins found in the cytosol
  3. B) the release of more signal molecules
  4. C) a change in the activity of an enzyme
  5. D) All of these choices are correct.

 

 

  1. The ability of a specific tissue or organ to respond to the presence of a hormone is dependent on:
  2. A) the location of the tissue or organ with respect to the circulatory path.
  3. B) the membrane potential of the cells of the target organ.
  4. C) the presence of the appropriate receptors on the cells of the target tissue or organ.
  5. D) All hormones of the body are able to stimulate all cell types because hormones are powerful and nonspecific.

 

 

  1. The first event that happens after a signaling molecule binds to a receptor is:
  2. A) the receptor transmits the message in a process called signal transduction.
  3. B) there is a cellular response.
  4. C) the receptor is activated.
  5. D) the signal is quickly terminated to ensure a moderate response.

 

 

  1. Recall from the text the example of cell communication in Streptococcus pneumoniae: The rate of DNA uptake by pneumococcal cells increases sharply when they are at high density, due to changes in gene expression brought about by signaling between cells. If the pneumococcal cells did not express receptor proteins, how would the rate of DNA uptake be affected when the cells reach high density?
  2. A) There would be no change in the rate of DNA uptake.
  3. B) There would be a larger than normal increase in the rate of DNA uptake.
  4. C) There would be a smaller than normal increase in the rate of DNA uptake.
  5. D) There would be a decrease in the rate of DNA uptake.

 

 

  1. Many diseases are the result of a problem with cell signaling. Which of the following diseases BEST exemplifies this fact?
  2. A) cystic fibrosis, which is caused by a mutation in a channel protein, resulting in a buildup of mucus
  3. B) congestive heart failure, which is caused by chronic high blood pressure due to excessive sodium intake
  4. C) a specific type of cancer, which is caused by a truncated receptor that becomes stuck in the activated for.
  5. D) familial hypercholesterolemia (high cholesterol in the blood), which is caused by a decrease in the number of receptors for cholesterol.

 

 

  1. In many signaling pathways, once a signaling molecule binds to a receptor, the receptor becomes phosphorylated. This initial phosphorylation step BEST demonstrates:
  2. A) receptor activation.
  3. B) signal transduction.
  4. C) cellular response.
  5. D)
  6. E) either cellular response or signal transduction.

 

 

  1. Many scientists use chemical inhibitors to interfere with normal signaling pathways within eukaryotic cells. If such inhibitors are large, nonpolar molecules, what is the likely method of action of these chemical inhibitors?
  2. A) These chemical inhibitors likely enter eukaryotic cells and interfere with components of the signal transduction pathway.
  3. B) These chemical inhibitors likely enter the nucleus and prevent the transcription of the pathway of interest’s target genes.
  4. C) These chemical inhibitors likely bind to receptors and interfere with receptor activation or signal-receptor binding.
  5. D) These chemical inhibitors likely interfere with the termination of signaling, so eukaryotic cells can’t process new signals.

 

 

  1. A researcher introduces a signal produced by bacteria to eukaryotic cells that she is culturing in the laboratory. Remarkably, she notices that this signal results in an increase in eukaryotic gene expression.  How is this possible?
  2. A) This signal is likely similar in structure to ligands utilized by eukaryotic cells.
  3. B) This signaling pathway might actually be used by both prokaryotes and eukaryotes.
  4. C) This gene expression is likely independent of the presence of the prokaryotic signal.
  5. D) This prokaryotic signal likely travels directly into eukaryotic cells and acts as a transcription factor.
  6. E) The signal is either similar in structure to a ligand used by eukaryotes, or this signaling pathway is used by both prokaryotes and eukaryotes.

 

 

  1. A cell can only respond to signals from other cells, not from the physical environment.
  2. A) True
  3. B) False

 

 

  1. Vascular endothelial growth factor (abbreviated VEGF and pronounced “Veg-F”) is a peptide signaling molecule related to platelet-derived growth factor. VEGF is important in the formation of the circulatory system because its signaling pathway causes the formation of blood vessels in developing embryos during normal development. Tumors also produce and secrete VEGF, causing the formation of new blood vessels that supply these tumors. Given what you know about the different kinds of cell signaling and VEGF, which one of the following statements is TRUE?
  2. A) VEGF is an endocrine-signaling molecule because it circulates through the bloodstream inside of platelets.
  3. B) VEGF is an endocrine-signaling molecule because it is released from platelets into the bloodstream and is carried throughout the body, causing widespread activation of platelet-derived growth factor receptors on cells in a variety of tissues.
  4. C) VEGF is a paracrine signaling molecule because it binds to receptors on cells at the site where new blood vessels are needed.

 

 

  1. Vascular endothelial growth factor (abbreviated VEGF and pronounced “Veg-F”) is a peptide signaling molecule related to platelet-derived growth factor. VEGF is important in the formation of the circulatory system because its signaling pathway causes the formation of new blood vessels in developing embryos during normal development. Tumors also produce and secrete VEGF, causing the formation of new blood vessels that supply these tumors. Given what you know about the different kinds of cell signaling and about VEGF, is VEGF a paracrine or an endocrine-signaling molecule? Justify your answer.

 

 

  1. Which type of cell signaling does not rely on the diffusion of a chemical signal molecule?
  2. A) contact-dependent
  3. B) paracrine
  4. C) autocrine
  5. D) endocrine
  6. E) All of these choices are correct.

 

 

  1. Communication between neurons is an example of which type of cell signaling?
  2. A) contact-dependent
  3. B) paracrine
  4. C) autocrine
  5. D) endocrine
  6. E) All of these choices are correct.

 

 

  1. Platelet-derived growth factor (PDGF) is a signaling molecule that functions in which of the following types of cell signaling?
  2. A) contact-dependent
  3. B) paracrine
  4. C) autocrine
  5. D) endocrine
  6. E) All of these choices are correct.

 

 

  1. Which of the following is a type of cell communication where the signaling molecule is released by the same cell that responds to the signal?
  2. A) contact-dependent
  3. B) paracrine
  4. C) autocrine
  5. D) endocrine
  6. E) All of these choices are correct.

 

 

  1. Kohler and Lipton first discovered platelet-derived growth factor by observing that fibroblasts:
  2. A) could not grow in cell culture without adding PDGF to the growth medium.
  3. B) could not grow in cell culture without adding bovine blood serum to the growth medium.
  4. C) grew better in cell culture when blood serum was added to the growth medium instead of
  5. D) blood plasma.
  6. E) could not grow and repair wounding without the action of platelets.
  7. F) could not grow in cell culture without the addition of purified red blood cells.

 

 

  1. Which of the following is TRUE about the Delta protein?
  2. A) Delta is a transmembrane protein found in embryonic brain cells.
  3. B) Delta is produced by embryonic stem cells as they differentiate into neurons in the brain.
  4. C) Delta directly signals to a Notch transmembrane protein in adjacent cells.
  5. D) Delta directs adjacent cells to differentiate into glial cells.
  6. E) All of these choices are correct.

 

 

  1. You create a cell that has a mutation in a receptor protein that binds a signaling molecule, which is also produced by the same cell. When you overexpress the signaling molecule produced by this cell, nothing happens. What is defective in this cell?
  2. A) endocrine signaling
  3. B) contact-dependent signaling
  4. C) paracrine signaling
  5. D) autocrine signaling

 

 

  1. Of the choices below, what is the MOST likely reason that paracrine signaling does not activate the cell that is producing the signaling molecule?
  2. A) The concentration of the signaling molecule is not high enough.
  3. B) The neighboring cells are too far away.
  4. C) The cell does not have the proper receptor.
  5. D) The cell’s receptors have a mutation.

 

 

  1. The differentiation of embryonic stem cells into neurons and glial cells is a consequence of which type of cell signaling?
  2. A) contact-dependent
  3. B) paracrine
  4. C) autocrine
  5. D) endocrine
  6. E) All of these choices are correct.

 

 

  1. Which of the following CORRECTLY lists the types of cellular communication from shortest to longest distance traveled by the signaling molecule to reach its responding cell?
  2. A) paracrine, autocrine, endocrine
  3. B) autocrine, endocrine, paracrine
  4. C) autocrine, paracrine, endocrine
  5. D) endocrine, paracrine, autocrine

 

 

  1. Which of the following types of cell signaling generally occurs between cells that are distant from each other?
  2. A) paracrine
  3. B) autocrine
  4. C) endocrine
  5. D) All of these choices are correct.

 

 

  1. Types of steroids include:
  2. A) sex hormones such as estrogen and testosterone.
  3. B) glucocorticoids that regulate blood glucose levels.
  4. C) insect molting hormones.
  5. D) lipid-soluble hormones derived from cholesterol.
  6. E) All of these choices are correct.

 

 

  1. Mammalian steroid hormones are signaling molecules that function in which of the following types of cell signaling?
  2. A) paracrine
  3. B) autocrine
  4. C) endocrine
  5. D) All of these choices are correct.

 

 

  1. Cell signaling over a long distance is known as _____ signaling.
  2. A) paracrine
  3. B) endocrine
  4. C) contact-dependent
  5. D) autocrine

 

 

  1. What is a growth factor?
  2. A) a small protein that influences cell growth and division
  3. B) a signaling molecule involved in paracrine signaling
  4. C) a soluble molecule that can alter gene expression in a cell
  5. D) All of these choices are correct.

 

 

  1. The signaling molecule involved in contact-dependent cell signaling is a:
  2. A) small soluble peptide.
  3. B)
  4. C) transmembrane protein.
  5. D) growth factor.

 

 

  1. Which signaling system involves the LONGEST time interval between release of a signaling molecule and activation of a receptor?
  2. A) autocrine
  3. B) contact-dependent
  4. C) paracrine
  5. D) endocrine

 

 

  1. Cell signaling between two nerve cells can be thought of as an example of paracrine signaling because:
  2. A) a signaling molecule (neurotransmitter) is released.
  3. B) a receptor is activated.
  4. C) the cells are in close proximity.
  5. D) the responding cell releases more of the signaling molecule (neurotransmitter).

 

 

  1. Growth factors, such as platelet-derived growth factor, function in _____ signaling.
  2. A) autocrine
  3. B) paracrine
  4. C) endocrine
  5. D) contact-dependent

 

 

  1. In the developing nervous system, _____ is the signaling molecule that results in the differentiation of _____.
  2. A) Notch; neurons
  3. B) Notch; glial cells
  4. C) Delta; glial cells
  5. D) Delta; neurons

 

 

  1. Review the experiments by Kohler and Lipton described in Figure 9.5. What is the key difference between blood serum and blood plasma that affects their ability to help fibroblasts grow in culture?

 

 

 

  1. A) Serum contains more platelet cells than plasma, and platelet cells promote cell growth.
  2. B) Molecules found in serum promote cell growth; these molecules are not found in plasma.
  3. C) Plasma contains more platelet cells than serum, and platelet cells inhibit cell growth.
  4. D) Molecules found in plasma inhibit cell growth; these molecules are not found in serum.

 

 

  1. Notch and Delta are both transmembrane proteins involved in cell communication in the developing nervous system of vertebrate animals. What makes Notch different from Delta?
  2. A) Notch is a receptor, and Delta is a signaling molecule.
  3. B) Notch is a signaling molecule, and Delta is a receptor.
  4. C) Notch is required at higher density than Delta to alter cell fate.
  5. D) All of these choices are correct.

 

 

  1. Based on the data provided in the two graphs shown in Figure 9.5, which method of culturing resulted in the greatest number of fibroblast cells on day 6?

 

 

 

  1. A) fibroblasts cultured with serum
  2. B) fibroblasts cultured with platelet proteins
  3. C) fibroblasts cultured with plasma
  4. D) The same results are obtained whether the fibroblasts are cultured with serum or with platelet proteins.

 

 

  1. Which of the following signaling molecules would you expect to travel the LONGEST distance in the human body?
  2. A) testosterone
  3. B) Delta
  4. C) PDGF
  5. D) neurotransmitters
  6. E) Notch

 

 

  1. Which of the following statements is FALSE regarding a neurotransmitter?
  2. A) Neurotransmitters are typically dispersed over small distances.
  3. B) Similar to Delta or Notch, neurotransmitters are usually attached to the cell surface.
  4. C) Neurotransmitters can be growth factors.
  5. D) Neurotransmitters play a role in muscle contraction.
  6. E) Neurotransmitters are produced by neurons.

 

 

  1. Imagine that a researcher is studying the embryonic development of mice that do not express the signal molecule Delta. What will likely be TRUE of these mice?
  2. A) These mice will have more neurons compared with their normal counterparts.
  3. B) These mice will have fewer neurons compared with their normal counterparts.
  4. C) These mice will have more glia compared with their normal counterparts.
  5. D) The mice will have fewer glia compared with their normal counterparts.
  6. E) The mice will have fewer neurons and more glia compared with their normal counterparts.

 

 

  1. A researcher is evaluating the role of a growth factor during embryonic development. She notices that this factor functions in both neural development and limb development.  How is that possible?
  2. A) The effects of the growth factor may be concentration-dependent.
  3. B) The effects of the growth factor may be dependent on location.
  4. C) The growth factor may result in the transcription of different genes, depending on cell type.
  5. D) The growth factor may be signaling through different transduction pathways.
  6. E) All of these choices are possible explanations for the observations.

 

 

  1. Signaling molecules involved in paracrine and autocrine signaling:
  2. A) remain attached to the plasma membrane.
  3. B) travel by diffusion.
  4. C) travel in the circulatory system.

 

 

  1. Which of the following would NOT be considered a cell-surface receptor?
  2. A) a receptor that binds a nonpolar steroid hormone and activates transcription
  3. B) a receptor that allows ions to enter the cell when a ligand binds
  4. C) a receptor that causes GDP to be exchanged for GTP in a G protein
  5. D) a receptor that must form a dimer after binding the ligand to transmit a signal

 

 

  1. Describe how a nonpolar steroid hormone receptor is different from a cell-surface receptor.

 

 

  1. A drug designed to inhibit the response of cells to the steroid testosterone would almost certainly result in which of the following?
  2. A) lower levels of cAMP
  3. B) a decrease in receptor kinase activity
  4. C) a decrease in the transcription of certain genes
  5. D) an increase in cytosolic calcium levels
  6. E) a decrease in G protein activity

 

 

  1. Which one of the following would be found bound to the regulatory region of a gene?
  2. A) steroid hormone receptor
  3. B) MAP kinase
  4. C) adenylyl cyclase
  5. D) cAMP
  6. E) protein kinase A

 

 

  1. How are steroid hormone receptors and cell-surface receptors similar?
  2. A) When bound to their ligand, both types enter the nucleus to activate transcription.
  3. B) Both types cause G proteins to exchange GDP for GTP.
  4. C) Both types undergo a conformational change when they bind to their ligand.
  5. D) When activated, both types carry signals across the plasma membrane.

 

 

  1. How are steroid hormone receptors and cell-surface receptors similar?

 

 

  1. Ion channels can be involved in cell signaling because:
  2. A) they interact with G proteins.
  3. B) they lead to receptor phosphorylation.
  4. C) their signal is amplified in the cell by a series of phosphorylation events.
  5. D) they receive signals from other cells and lead to a cellular response.
  6. E) Ion channels are not involved in cell signaling.

 

 

  1. Despite their differences, steroid hormones:
  2. A) have the same effect on different types of cells.
  3. B) bind to cell-surface receptors.
  4. C) bind intracellular receptors to form complexes that enter the nucleus.
  5. D) are hydrophilic small molecules that bind to intracellular receptors.
  6. E) facilitate the initiation of translation by ribosomes.

 

 

  1. Which type of receptor does NOT generally lead to a signaling cascade in the cell that involves the transfer of phosphate groups? (Select all that apply.)
  2. A) G protein–coupled receptor
  3. B) receptor kinase
  4. C) ligand-gated ion channel
  5. D) intracellular receptor

 

 

  1. Which of the following would NOT be considered a cell-surface receptor?
  2. A) a receptor that binds a nonpolar steroid hormone and activates transcription
  3. B) a receptor that allows ions to enter the cell when a ligand binds
  4. C) a receptor that causes GDP to be exchanged for GTP in a G protein
  5. D) a receptor that forms a dimer after binding the ligand

 

 

  1. According to Figure 9.6, what is a key difference between cell signaling by a cell-surface receptor and cell signaling by an intracellular receptor?

 

 

  1. A) Cell-surface receptors bind to specific signaling molecules; intracellular receptors bind any signaling molecule.
  2. B) Cell-surface receptors typically bind to signaling molecules that are smaller than those bound by intracellular receptors.
  3. C) Cell-surface receptors bind polar signaling molecules; intracellular receptors bind nonpolar signaling molecules.
  4. D) Signaling molecules that bind to cell-surface receptors lead to cellular responses restricted to the cytoplasm; signaling molecules that bind to intracellular receptors lead to cellular responses restricted to the nucleus.
  5. E) None of the other answer options is correct.

 

 

  1. Which type of receptor is involved in rapid responses of muscle cells and neurons?
  2. A) G protein–coupled receptor
  3. B) receptor kinase
  4. C) ligand-gated ion channel
  5. D) intracellular receptor

 

 

  1. You strip off all proteins on the cell surface by using a protease (an enzyme that destroys proteins). Now, when you add a specific signaling molecule, the cell still responds. Why is this?
  2. A) The signaling molecule doesn’t need a receptor.
  3. B) The signaling molecule is polar and can diffuse into the cell.
  4. C) The receptor is in the interior of the cell.
  5. D) The signaling molecule is nonpolar and binds a cell-surface receptor.

 

 

  1. Which type of receptor is membrane-associated? (Select all that apply.)
  2. A) G protein–coupled receptor
  3. B) receptor kinase
  4. C) ligand-gated ion channel
  5. D) intracellular receptor

 

 

  1. Which type of receptor undergoes a conformational change upon activation? (Select all that apply.)
  2. A) G protein–coupled receptor
  3. B) receptor kinase
  4. C) ligand-gated ion channel
  5. D) intracellular receptor

 

 

  1. In the context of cell signaling, to what does the term ligand refer?
  2. A) a signaling molecule
  3. B) the extracellular domain of a receptor protein
  4. C) the proteins activated as part of a signal transduction pathway
  5. D) a type of gated channel

 

 

  1. What determines the specificity of a receptor protein?
  2. A) the cytoplasmic domain
  3. B) the transmembrane domain
  4. C) the ligand-binding site
  5. D) the extracellular domain

 

 

  1. Which one of the following is NOT a cell surface–type receptor?
  2. A) G protein–coupled receptor
  3. B) steroid receptor
  4. C) ligand-gated receptor
  5. D) receptor kinase

 

 

  1. What is the cell’s likely response to ligand binding to a steroid receptor located in the nucleus?
  2. A) a change in gene expression
  3. B) activation of a kinase
  4. C) initiation of a signal transduction pathway
  5. D) change in ion transport

 

 

  1. Which type of cell-surface receptor undergoes changes in phosphorylation in response to binding of its ligand?
  2. A) G protein–coupled receptor
  3. B) receptor kinase
  4. C) ligand-gated ion channel
  5. D) both the G protein–coupled receptor and the receptor kinase

 

 

  1. Which type of protein adds a phosphate group to another molecule?
  2. A) kinase
  3. B) G protein
  4. C) phosphatase
  5. D) phosphorylase

 

 

  1. How does an “activated” receptor transfer information into the cell?
  2. A) by altering the ligand-binding site of the receptor
  3. B) through a conformational change of the receptor
  4. C) by decreased phosphorylation of the receptor
  5. D) by increased translation of the receptor

 

 

  1. Where would you expect to find the receptor for a nonpolar ligand?
  2. A) on the cell surface
  3. B) in the nucleus of the cell
  4. C) in the cytosol
  5. D) either in the nucleus of the cell or in the cytosol

 

 

  1. What does a ligand-gated channel do?
  2. A) It binds small, nonpolar signaling molecules.
  3. B) It activates a G protein.
  4. C) It allows ions to move across the plasma membrane.
  5. D) It triggers the activity of a phosphatase.

 

 

  1. Which of the following is a FALSE statement about receptors that are localized to the nucleus?
  2. A) They are synthesized in the cytosol.
  3. B) They carry a nuclear-localization signal.
  4. C) They bind polar ligands.
  5. D) They move through a nuclear pore.

 

 

  1. Why don’t steroid hormones bind to transmembrane cell-surface receptors?
  2. A) Steroid hormones don’t require receptors because they bind directly to DNA.
  3. B) Steroid hormones are not signaling molecules.
  4. C) Steroid hormones are nonpolar and, therefore, cannot bind to receptors.
  5. D) Steroid hormones are nonpolar and, therefore, are able to cross the cell’s plasma membrane, thus binding to receptors inside the cell.

 

 

  1. Given that most ligands form covalent bonds with their associated receptors, these complexes are more or less permanent and can only be broken through the hydrolysis of ATP.
  2. A) True
  3. B) False

 

 

  1. A researcher has discovered a new ligand that can pass through the cell membrane and bind to a receptor in the nucleus. Which of the following statements is FALSE regarding this ligand?
  2. A) This ligand is likely a steroid.
  3. B) This ligand is likely nonpolar.
  4. C) This ligand likely has a similar structure to cholesterol.
  5. D) This ligand likely binds to a transmembrane receptor.
  6. E) This ligand likely plays a role in transcription.

 

 

  1. A researcher is using a small molecule as an inhibitor to manipulate a signaling pathway. This inhibitor prevents phosphorylation and MOST likely targets a:
  2. A) G protein–coupled receptor.
  3. B) G protein.
  4. C) receptor kinase.
  5. D) ligand-gated ion channel.
  6. E)

 

 

  1. A researcher is studying a G protein–coupled receptor in eukaryotic cells. In one group of cells, he notices that even though a ligand can bind to its G protein–coupled receptor, nothing happens.  Why could this happen?
  2. A) The G protein–coupled receptor might carry a mutation, so that it fails to undergo a conformational change upon the binding of its ligand.
  3. B) The G protein–coupled receptor might carry a mutation that affects the receptor’s transmembrane portion.
  4. C) These cells might carry mutations in the downstream signaling pathway associated with this G protein–coupled receptor.
  5. D) All of these choices are correct.

 

 

  1. A bacterium releases a toxin that binds to and activates a G protein-coupled receptor in the mammalian gut. The result is high levels of cAMP in these cells. This toxin might work by:
  2. A) binding to and activating the G protein–coupled receptor in these cells.
  3. B) binding to and inhibiting the G protein–coupled receptor in these cells.
  4. C) causing the  subunit of the G protein to stay associated with the  and  subunits.
  5. D) causing the  subunit of the G protein to bind GDP constantly.
  6. E) causing adenylyl cyclase to dissociate from the membrane.

 

 

  1. A newly discovered signaling molecule that binds to a G protein–coupled receptor is being studied by using cells maintained in cell culture. Preliminary results show that the binding of this new ligand causes the activation of adenylyl cyclase. In the next part of this study, a non-hydrolyzable version of GTP (a form of GTP that cannot be converted to GDP) is added to the cell culture dishes and is taken up by the cells. Which of the following would you expect to observe?
  2. A) increased cAMP, decreased protein kinase A activity
  3. B) decreased cAMP, decreased protein kinase A activity
  4. C) decreased cAMP, increased protein kinase A activity
  5. D) increased cAMP, increased protein kinase A activity

 

 

  1. Which of the following events are listed in the CORRECT order?
  2. A) cAMP activates adenylyl cyclase, which activates protein kinase A
  3. B) protein kinase A phosphorylates adenylyl cyclase, which then synthesizes cAMP from ATP
  4. C) adenylyl cyclase catalyzes the formation of cAMP, which activates protein kinase A

 

 

  1. An increased heart rate caused by the release of adrenaline from the adrenal glands is an example of _____ signaling.
  2. A) autocrine
  3. B) contact-dependent
  4. C) paracrine
  5. D) endocrine

 

 

  1. The high variability of the types of G protein–coupled receptors allows:
  2. A) different types of cells to respond to different types of signals.
  3. B) different types of signal-transduction pathways to respond to signals.
  4. C) a rapid response to cell signals.
  5. D) a sensitive response to cell signals.
  6. E) All of these choices are correct.

 

 

  1. When a ligand binds to a G protein–coupled receptor, which of the following would you expect to happen FIRST?
  2. A) The amount of cAMP in the cytoplasm increases.
  3. B) Protein kinase activity increases.
  4. C) Adenylyl cyclase activity increases.
  5. D) Phosphodiesterase activity increases.
  6. E) None of the other answer options is correct.

 

 

  1. Which of the following terminates a cell-signaling event that is initiated by a G protein–coupled receptor?
  2. A) phosphatase activity
  3. B) protein kinase activity
  4. C) adenylyl cyclase activity
  5. D) phosphodiesterase activity
  6. E) None of the other answer options is correct.

 

 

  1. Which of the following is/are true about G proteins? (Select all that apply.)
  2. A) All G proteins associate with G protein–coupled receptors.
  3. B) Some G proteins are composed of three subunits.
  4. C) G proteins release GDP and bind GTP when associated with an activated receptor.
  5. D) G proteins become deactivated when bound GTP is hydrolyzed to GDP.
  6. E) All of these choices are correct.

 

 

  1. According to Figure 9.11, which of the following is NOT responsible for amplifying the signal in a cell responding to adrenaline signaling?

 

  1. A) One adrenaline molecule can bind to and activate many receptors simultaneously.
  2. B) One molecule of adenylyl cyclase can produce many molecules of cAMP.
  3. C) One molecule of protein kinase A can phosphorylate and activate many target proteins.
  4. D) One activated receptor can activate many G proteins.

 

 

  1. Which type of receptor needs an accessory protein to signal?
  2. A) G protein–coupled receptor
  3. B) receptor kinase
  4. C) ligand-gated ion channel
  5. D) None of the other answer options is correct.

 

 

  1. How would the signal of a G protein–coupled receptor, without ligand, be affected if you made a G protein that converted GDP to GTP on its own without needing to be activated by the G protein–coupled receptor?
  2. A) The signal wouldn’t be affected; there is no ligand, thus no signal.
  3. B) The signal wouldn’t be affected; the ligand would be unable to bind due to the conformational change.
  4. C) The G protein would be active but unable to signal due to the lack of ligand.
  5. D) The G protein would be active and signaling, despite the lack of ligand.

 

 

  1. The extent and duration of a cellular response to a signal depend on the:
  2. A) binding affinity of the receptor to the signaling molecule.
  3. B) concentration of the signaling molecule in the vicinity of the receptor.
  4. C) level of expression of the signal transduction proteins.
  5. D) level of expression of proteins that terminate the response.
  6. E) All of these choices are correct.

 

 

  1. Which of the following steps in a signaling cascade initiated by a G protein–coupled receptor would be DIRECTLY affected in cells cultured in the presence of a non-hydrolyzable ATP analog (the analog could bind to other molecules, but could not be converted to ADP and Pi)? (Select all that apply.)
  2. A) protein phosphatase activity
  3. B) protein kinase activity
  4. C) adenylyl cyclase activity
  5. D) phosphodiesterase activity

 

 

  1. Which of the following is responsible for the amplification of an intracellular signal? (Select all that apply.)
  2. A) protein phosphatase activity
  3. B) protein kinase activity
  4. C) adenylyl cyclase activity
  5. D) phosphodiesterase activity

 

 

  1. Which of the following CORRECTLY pairs enzymes that activate and terminate the same step in a signaling event? (Select all that apply.)
  2. A) adenylyl cyclase (activates) and phosphodiesterase (terminates)
  3. B) protein kinase (activates) and phosphatase (terminates)
  4. C) protein kinase (activates) and phosphodiesterase (terminates)
  5. D) adenylyl cyclase (activates) and phosphatase (terminates)

 

 

  1. Second messengers:
  2. A) are small intracellular molecules that participate in signal transduction.
  3. B) play a role in activation of intracellular signal transduction.
  4. C) are removed in order to terminate a cellular signaling response.
  5. D) amplify the effects of the signal.
  6. E) All of these choices are correct.

 

 

  1. How many subunits make up some types of G protein?
  2. A) two
  3. B) three
  4. C) four
  5. D) five
  6. E) six

 

 

  1. GTP binding occurs on which subunit of a G protein?
  2. A) the alpha subunit
  3. B) the beta subunit
  4. C) the gamma subunit
  5. D) GTP binds both beta and gamma subunits.

 

 

  1. What is the function of adenylyl cyclase?
  2. A) to form protein kinase A
  3. B) to phosphorylate protein kinase A
  4. C) to form cyclic AMP
  5. D) to phosphorylate cyclic AMP

 

 

  1. Cyclic AMP (cAMP) is an example of a(n):
  2. A) second messenger.
  3. B)
  4. C) effector or target protein.
  5. D) G protein.

 

 

  1. Inactivation of a cell-surface receptor depends on:
  2. A) the binding affinity of the receptor.
  3. B) the activity of phosphatases in the cytosol.
  4. C) the concentration of ligand surrounding the cell.
  5. D) both the binding affinity of the receptor and concentration of ligand surrounding the cell.

 

 

  1. What is the very FIRST effect of ligand binding to a G protein–coupled receptor?
  2. A) the activation of an effector protein
  3. B) the release of the alpha subunit of the G protein
  4. C) a conformational change in the cytoplasmic domain of the receptor
  5. D) an exchange of GTP in place of GDP on the alpha subunit of the G protein

 

 

  1. In order for a G protein to be active:
  2. A) the alpha subunit must bind GTP.
  3. B) the beta and gamma subunits must separate from the alpha subunit.
  4. C) both the beta and gamma subunits must bind GTP.
  5. D) the alpha subunit must bind GTP, and the beta and gamma subunits must separate from the alpha subunit.

 

 

  1. What happens to the alpha subunit of a G protein with GDP attached?
  2. A) It re-assembles with the beta and gamma subunits.
  3. B) It no longer activates an effector protein.
  4. C) It re-associates with the G protein–coupled receptor.
  5. D) All of these choices are correct.

 

 

  1. Signal amplification relies on:
  2. A) increasing amounts of ligand as signal transduction proceeds.
  3. B) a sequential increase in the different components of the signal transduction pathway.
  4. C) increasing numbers of cell-surface receptors as the signal is transduced.
  5. D) increased activity of protein phosphatases.

 

 

  1. What causes the inactivation of a G protein?
  2. A) The alpha subunit catalyzes the hydrolysis of GTP to GDP and inorganic phosphate.
  3. B) The beta and gamma subunits trigger the hydrolysis of GTP to GDP.
  4. C) A phosphatase removes the inorganic phosphate group from GTP.
  5. D) The inactive receptor catalyzes the replacement of GTP by GDP.

 

 

  1. How is a G protein classified?
  2. A) It is a transmembrane protein.
  3. B) It is a peripheral membrane protein.
  4. C) It is an integral membrane protein.
  5. D) It is a second messenger.

 

 

  1. The activation of protein kinase A by cyclic AMP binding likely occurs because of:
  2. A) the activity of a phosphatase.
  3. B) the binding of GTP to protein kinase A.
  4. C) the phosphorylation of protein kinase A.
  5. D) a conformational change to protein kinase A.

 

 

  1. In the G protein–coupled signal transduction pathway, phosphatases are responsible for the inactivation of:
  2. A) the alpha subunit of a G protein.
  3. B) protein kinase A.
  4. C) adenylyl cyclase.
  5. D) the protein target activated by protein kinase A.
  6. E) All of these choices are correct.

 

 

  1. G protein–coupled receptors:
  2. A) are only present in humans.
  3. B) are widespread and have diverse effects.
  4. C) are ion channels.
  5. D) become phosphorylated on binding a signaling molecule.
  6. E) All of these choices are correct.

 

 

  1. Termination is an important step in adrenaline signaling because it:
  2. A) prevents an excessive response to adrenaline.
  3. B) allows organisms to respond to new stresses.
  4. C) allows an appropriate level of response.
  5. D) All of these choices are correct.

 

 

  1. Phosphatases are a family of enzymes that remove phosphate groups from specific proteins; these phosphate groups had been added to the proteins by protein kinases. Vanadate is an inhibitor of phosphatases in eukaryotic cells. What effect would vanadate have on the response of cells to signals received by receptor kinases?
  2. A) The response of the cell would last longer than it normally would.
  3. B) The response of the cell would be shorter than it normally would.
  4. C) The signal would still bind the receptor, so there would be no effect.

 

 

  1. Many mutations in receptor kinases that lead to cancer allow the receptor to dimerize and become activated, even in the absence of signaling molecules. An example is a mutant form of the EGF receptor kinase called Her2/neu. An antibody that prevents dimerization of Her2/neu receptor kinases is being tested for its effectiveness in preventing cancer.  At which stage does this drug work?
  2. A) It prevents the signaling cell from producing the signal.
  3. B) It prevents the receptor from binding to the signal.
  4. C) It prevents the receptor from becoming activated.
  5. D) It prevents the termination of the signal.

 

 

  1. You are studying a newly discovered growth factor. You find that this growth factor stimulates the proliferation of chicken cells grown in the laboratory. You have also found that the receptor that binds the growth factor is a receptor kinase. Which of the following mutations would you expect to promote uncontrolled cell proliferation?
  2. A) a mutation that prevents dimerization of the receptor
  3. B) a mutation that destroys the kinase activity of the receptor
  4. C) a mutation that inactivates the phosphatase that dephosphorylates the activated receptor
  5. D) a mutation that prevents the binding of the normal extracellular signal to the receptor

 

  1. Which of the following is circled in this electron micrograph?

 

Photo credit: Biophoto Associates/Science Source

  1. A) one double-stranded DNA molecule
  2. B) one single strand of a DNA molecule
  3. C) two double-stranded DNA molecules

 

 

  1. Prokaryotic cells and eukaryotic cells reproduce by mitotic cell division. Regardless of the type of cell, all cells must _____ before they divide.
  2. A) make a copy of their genetic information
  3. B) separate sister chromatids from one another
  4. C) complete mitosis
  5. D) reconstruct their nucleus

 

 

  1. The CORRECT sequence of steps in the eukaryotic cell cycle is:
  2. A) G1  S phase  G2  mitosis  cytokinesis.
  3. B) G0  S phase  G1  S phase  G2  mitosis  cytokinesis.
  4. C) G0  S phase  G1  G2  cytokinesis  mitosis.
  5. D) G0  S phase  G1  S phase  G2  cytokinesis  mitosis.
  6. E) G1  S phase  G2  cytokinesis  mitosis.

 

 

  1. It is estimated that there are a total of 50–100 trillion cells in the human body. Starting from a fertilized egg, how many cell divisions would be required to produce 50 trillion cells, assuming that every cell divides in every cycle?
  2. A) 455 divisions
  3. B) 5 divisions
  4. C) 100 divisions
  5. D) one division per day for nine months

 

 

  1. Which of the following steps in prokaryotic binary fission is CORRECT?
  2. A) DNA is replicated bidirectionally from a single point on the circular chromosome.
  3. B) The two replicated chromosomes remain attached to the plasma membrane.
  4. C) The cell continues to grow outward symmetrically, separating the two chromosomes.
  5. D) Cell wall material is laid down at the midpoint to separate the two daughter cells.
  6. E) All of these choices are correct.

 

 

  1. Which of the following is NOT true about the eukaryotic cell cycle?
  2. A) There are two stages to the cell cycle: M phase and interphase.
  3. B) The M phase consists of two events: mitosis and cytokinesis.
  4. C) Interphase is typically the shortest of the two stages of the cell cycle.
  5. D) There are three phases of interphase: the S phase and two gap phases.
  6. E) Some cells pause between M phase and S phase for more than a year.

 

 

  1. The genetic information of daughter cells is always exactly the same as the genetic information of the parent in binary fission.
  2. A) True
  3. B) False

 

 

  1. A mutation acquired by a bacterium will very likely be inherited by all daughter cells.
  2. A) True
  3. B) False

 

 

  1. Mitosis MOST likely evolved from what process?
  2. A) meiosis
  3. B) the cell cycle
  4. C) cytokinesis
  5. D) binary fission

 

 

  1. A skin cell in G2 of interphase has _____ as much DNA as it had in G1.
  2. A) half
  3. B) twice
  4. C) exactly
  5. D) one-fourth
  6. E) four times

 

 

  1. All of the following happen during mitosis EXCEPT:
  2. A) condensing of chromosomes.
  3. B) synthesis of DNA.
  4. C) formation of the spindle.
  5. D) separation of sister chromatids at the centromeres.

 

 

  1. Paramecium is a single-cell eukaryotic organism that can reproduce by mitotic cell division. Prior to the M phase of the cell cycle, which of the following must occur?
  2. A) The cell must replicate its chromosomes.
  3. B) The cell must first be fertilized.
  4. C) The nucleus must divide.
  5. D) Sister chromatids must be separated.
  6. E) The nuclear envelope must disintegrate.

 

 

  1. Given that the correct number of chromosomes is vital to the proper functioning of a cell, which of the statements below is CORRECT if a cell passes from G1 to S phase in the cell cycle?
  2. A) The cell copies its chromosomes and enters G2 or it returns to G1.
  3. B) The cell completes the process of cell division or it dies.
  4. C) The cell divides or it returns to G1 and enters G0.

 

 

  1. Which of the following is NOT true of mitotic cell division?
  2. A) It occurs in eukaryotes, but not in prokaryotes.
  3. B) It is a highly regulated process.
  4. C) It is a form of asexual reproduction.
  5. D) It is a process that is very important in the life cycle of sexually reproducing organisms.
  6. E) It does not require DNA replication.

 

 

  1. Which of the following reproduce by binary fission?
  2. A) bacteria
  3. B) archaea
  4. C) chloroplasts
  5. D) mitochondria
  6. E) All of these choices are correct.

 

 

  1. Reproduction by mitotic cell division:
  2. A) results in two daughter cells that are genetically identical.
  3. B) is asexual reproduction.
  4. C) persists in mature plant cells for continued growth.
  5. D) continues in mature adult humans to replace damaged and worn-out cells.
  6. E) All of these choices are correct.

 

 

  1. The process of cell division in a prokaryotic cell is called:
  2. A) binary fusion.
  3. B)
  4. C) binary fission.
  5. D)

 

 

  1. The division of genetic material in a eukaryotic cell is called:
  2. A) genetic fission.
  3. B)
  4. C)
  5. D)

 

 

  1. The division of the cell’s cytoplasm in a eukaryotic cell is known as:
  2. A)
  3. B) cell fission.
  4. C)
  5. D) both cytokinesis and mitosis..

 

 

  1. Replication of DNA in a eukaryote occurs during which phase of the cell cycle?
  2. A) M phase
  3. B) G1 phase
  4. C) G2 phase
  5. D) S phase

 

 

  1. Which of the following is NOT a step in the process of binary fission?
  2. A) replication of DNA
  3. B) formation of a new cell wall
  4. C) rearrangement of the microtubule cytoskeleton
  5. D) elongation of the cell

 

 

  1. What is the role of the protein FtsZ?
  2. A) It forms a ring at the site of constriction.
  3. B) It is involved in the attachment of DNA to the plasma membrane.
  4. C) It is responsible for the replication of DNA.
  5. D) It forms the new cell wall between daughter cells.

 

 

  1. A cell that is not actively dividing is in what phase of the cell cycle?
  2. A) G1
  3. B) G0
  4. C) G1′
  5. D) G2

 

 

  1. What cellular process(es) is/are responsible for the increase in protein content associated with the gap phases of the cell cycle?
  2. A) gene expression
  3. B) glycolysis
  4. C) protein synthesis
  5. D) both gene expression and protein synthesis

 

 

  1. The prokaryotic protein FtsZ is evolutionarily related to eukaryotic tubulin. What does this mean?
  2. A) The gene sequence for FtsZ is similar to tubulin.
  3. B) The amino acid sequence for FtsZ is similar to tubulin.
  4. C) The overall protein structure of FtsZ is similar to tubulin.
  5. D) The two proteins evolved from a common ancestral protein.
  6. E) All of these choices are correct.

 

 

  1. Why would a compound that interferes with bacterial cell wall synthesis be useful for treating a bacterial infection?
  2. A) It would prevent the cells from becoming larger.
  3. B) It would prevent replication of DNA.
  4. C) It would limit the spread of the infection through cell division.
  5. D) It would prevent replication of DNA, and it would limit the spread of the infection.

 

 

  1. What would happen to the daughter cells if the G2 phase of the parent cell is shortened?
  2. A) The cells would be smaller than normal.
  3. B) The cells would be missing chromosomes.
  4. C) The cells would not undergo cytokinesis.
  5. D) The cells would be larger than normal.

 

 

  1. Muscle cells in the mammalian heart are multinucleate, meaning that multiple nuclei are present in the cytoplasm of a large cell. Predict what is different about the cell cycle in a muscle cell.
  2. A) The G1 and G2 phases are extended.
  3. B) Cytokinesis does not occur.
  4. C) S phase happens twice.
  5. D) M phase is inhibited.

 

 

  1. Evidence exists (especially in dinoflagellates) that mitosis evolved from binary fission. For example, in certain eukaryotic cells during mitosis, DNA is attached to the membrane of the nucleus (much like a circular chromosome of a bacterium is attached to the plasma membrane).
  2. A) True
  3. B) False

 

 

  1. Which of the following statements is TRUE regarding binary fission?
  2. A) Proteins only anchor the original circular genome to the plasma membrane; the copy produced by DNA replication is free floating.
  3. B) In binary fission, cell division is typically asymmetrical, with one daughter cell appearing much smaller than the other.
  4. C) Tubulin, rather than FtsZ, is responsible for cell division during binary fission.
  5. D) DNA replication during binary fission is a bidirectional process, occurring in opposite directions.
  6. E) None of the other answer options is correct.

 

 

  1. A researcher is studying a population of cells with two major phases. The first phase is relatively short (it lasts approximately 1 hour), whereas the second stage is much longer (it lasts approximately 12 hours) and is characterized by an increase in the DNA content of cells. This second stage is MOST likely:
  2. A)
  3. B)
  4. C)
  5. D)

 

 

  1. Which of the following is circled in this electron micrograph?

 

Photo credit: Biophoto Associates/Science Source

  1. A) one double-stranded DNA molecule
  2. B) one single strand of a DNA molecule
  3. C) two double-stranded DNA molecules

 

 

  1. How many copies of each gene are present in human skin cells at G1 of interphase?
  2. A) 2
  3. B) 4
  4. C) 6
  5. D) 8

 

 

  1. How many copies of each gene are present in human skin cells at G2 of interphase?
  2. A) 2
  3. B) 4
  4. C) 6
  5. D) 8

 

 

  1. Taxol is an anti-cancer drug that prevents uncontrolled cell proliferation by stabilizing microtubules, which causes arrest of the cell cycle. If dividing cells are treated with Taxol, at what stage of the cell cycle would you predict the arrest would occur?
  2. A) prophase
  3. B) metaphase
  4. C) anaphase
  5. D) telophase
  6. E) G1 of interphase

 

 

  1. In what way is cytokinesis in plant cells similar to binary fission in a bacterium?
  2. A) Cell wall material is deposited to separate the daughter cells.
  3. B) A ring of actin filaments constricts the plasma membrane between the two nuclei to separate the daughter cells.
  4. C) A microtubulin-like structure constricts the plasma membrane between the two nuclei to separate the daughter cells.
  5. D) A motor protein slides microtubules in a contractile ring at the plasma membrane between the two nuclei to separate the daughter cells.
  6. E) All of these choices are correct.

 

 

  1. In a dividing plant cell, a phragmoplast structure forms during telophase that directs vesicles carrying cell wall components to the middle of the cell, assembling a new cell wall called the cell plate.
  2. A) True
  3. B) False

 

 

  1. What would happen if a defect in S phase occurred during cell division? (Select all that apply.)
  2. A) There could be too few chromosomes.
  3. B) There could be too many chromosomes.
  4. C) There could be a lack of cytoplasm.
  5. D) All organelles may not be duplicated.

 

 

  1. What would happen during cell division if the cell is deficient in actin?
  2. A) The sister chromatids would not separate.
  3. B) The mitotic spindle would not form.
  4. C) The cell would not divide.
  5. D) The centromeres would not split.

 

 

  1. The CORRECT sequence of steps in the M phase of the cell cycle is:
  2. A) prophase, prometaphase, metaphase, anaphase, telophase, nuclear division.
  3. B) prophase, prometaphase, metaphase, anaphase, telophase, cytokinesis.
  4. C) prophase, metaphase, prometaphase, anaphase, nuclear division, telophase.
  5. D) prophase, metaphase, anaphase, telophase, cytokinesis, nuclear division.

 

 

  1. Sister chromatids are BEST described as two DNA molecules that have:
  2. A) the same genes in the same order but having different alleles.
  3. B) the same alleles of the same genes in a different order.
  4. C) different genes in the same order and possibly having different alleles of some genes.
  5. D) different alleles of the same genes arranged in a different order.
  6. E) virtually identical sequences of nucleotides.

 

 

  1. Is there a difference in genetic material between sister chromatids? Explain.

 

 

  1. Colchicine is a drug that is used in plant breeding to create polyploids. It blocks the assembly of microtubules. If dividing cells are treated with colchicine, at what stage of mitosis would you predict the arrest would occur?
  2. A) prophase
  3. B) metaphase
  4. C) late anaphase
  5. D) telophase
  6. E) G1 of interphase

 

 

  1. When homologous chromosomes are aligned with each other and arranged as pairs in order of decreasing size, the resulting portrait is referred to as a _____.

 

 

  1. Which of the following statements is NOT true about sister chromatids?
  2. A) They are identical or nearly identical DNA sequences.
  3. B) They are attached to each other at the centromere.
  4. C) They are formed in the S phase of the cell cycle when the chromosome undergoes replication.
  5. D) They are formed when the prokaryotic circular chromosome attaches at the plasma membrane.
  6. E) They are the same as homologous chromosomes.

 

 

  1. The centrosome is:
  2. A) a region of the chromosome where sister chromatids are attached to each other.
  3. B) a region of the chromosome where kinetochores attach.
  4. C) a region of the chromosome where microtubules attach to chromosomes during
  5. D) the microtubule organizing center for the mitotic spindle.
  6. E) All of these choices are correct.

 

 

  1. Asexual reproduction occurs in:
  2. A) unicellular eukaryotes.
  3. B) animal cells.
  4. C) plant cells.
  5. D) bacterial cells.
  6. E) All of these choices are correct.

 

 

  1. What is the function of histone proteins?
  2. A) to package DNA in eukaryotic chromosomes
  3. B) to connect chromosomes to the mitotic spindle
  4. C) to organize the microtubules that make up the spindle
  5. D) to attach sister chromatids together

 

 

  1. How many chromosome pairs are there in a normal human genome?
  2. A) 22
  3. B) 23
  4. C) 46
  5. D) 64

 

 

  1. What is the function of the centromere?
  2. A) to attach the DNA to the plasma membrane
  3. B) to attach the chromosome to the spindle
  4. C) to attach the sister chromatids to each other
  5. D) to organize the microtubules to form a spindle

 

 

  1. In which phase of mitosis do spindle microtubules shorten?
  2. A) prophase
  3. B) metaphase
  4. C) anaphase
  5. D) telophase

 

 

  1. In which phase of mitosis does the nuclear envelope reform?
  2. A) prophase
  3. B) metaphase
  4. C) anaphase
  5. D) telophase

 

 

  1. In which phase of mitosis do sister chromatids separate?
  2. A) prophase
  3. B) metaphase
  4. C) anaphase
  5. D) telophase

 

 

  1. In which phase of mitosis do chromosomes line up at the middle of the cell?
  2. A) prophase
  3. B) metaphase
  4. C) anaphase
  5. D) telophase

 

 

  1. In which phase of mitosis do chromosomes condense?
  2. A) prophase
  3. B) metaphase
  4. C) anaphase
  5. D) telophase

 

 

  1. In which phase of mitosis does the mitotic spindle form?
  2. A) prophase
  3. B) metaphase
  4. C) anaphase
  5. D) telophase

 

 

  1. A phragmoplast functions to:
  2. A) stimulate the growth of the microtubule spindle.
  3. B) anchor microtubules to sister chromatids.
  4. C) break down the nuclear envelope.
  5. D) form a new cell wall.

 

 

  1. Mitotic cell division is considered asexual because:
  2. A) the daughter cells receive DNA from one parent cell.
  3. B) this form of cell division is most similar to binary fission.
  4. C) the daughter cells are genetically identical.
  5. D) the daughter cells receive DNA from one parent cell, and the daughter cells are genetically identical.

 

 

  1. A human cell with a total of 23 chromosomes is:
  2. A)
  3. B)
  4. C)
  5. D)

 

 

  1. When in the cell cycle would you find sister chromatids?
  2. A) G1
  3. B) S
  4. C) G2
  5. D) S and G2

 

 

  1. At the start of mitosis, how many centromeres are present in a human cell?
  2. A) 12
  3. B) 23
  4. C) 46
  5. D) 92

 

 

  1. At the start of mitosis, how many sister chromatids are present in a human cell?
  2. A) 23
  3. B) 92
  4. C) 46
  5. D) 12

 

 

  1. What protein forms the contractile ring during cytokinesis in animal cells?
  2. A) kinesin
  3. B) actin
  4. C) dynein
  5. D) DNA polymerase

 

 

  1. Look carefully at the image of the human karyotype shown in Figure 11.3. What is the significance of the small differences between homologous chromosomes?

 

 

Photo credit: ISM/Phototake.

  1. A) Each homologous chromosome in a pair is from a different parent.
  2. B) Some of this person’s DNA is mutated, possibly causing disease.
  3. C) Chromosomes may not be completely replicated during S phase.
  4. D) The differences are a result of the way the material was prepared.

 

 

  1. Why are the X and Y chromosomes NOT considered homologous?
  2. A) they come from different parents
  3. B) they do not carry the same set of genes
  4. C) mammalian males carry two very different chromosomes
  5. D) they do not carry the same set of genes, and mammalian males carry two very different sex chromosomes

 

 

  1. The microtubules that form the mitotic spindle extend out from the centrosome. Where would you expect to find the plus (fast assembling) end of a spindle microtubule?
  2. A) at the centrosome
  3. B) away from the centrosome
  4. C) at the kinetochore
  5. D) away from the centrosome, at the kinetochore

 

 

  1. Why don’t plant cells use a contractile ring to divide their daughter cells?
  2. A) Plant cells don’t have an actin cytoskeleton.
  3. B) Plant cells don’t form daughter cells.
  4. C) A contractile ring can’t “pinch” a cell wall.
  5. D) Plant cells don’t have plasma membranes.

 

 

  1. What would happen if a chromosome only connected to the mitotic spindle at one of its kinetochores?
  2. A) One of the daughter cells would have an extra copy of that chromosome.
  3. B) The sister chromatids would not separate.
  4. C) The chromosome would not line up properly at metaphase.
  5. D) All of these choices are correct.

 

 

  1. A female Komodo dragon is diploid. She produces diploid offspring that are genetically identical to each other and to her. In this case, reproduction requires:
  2. A)
  3. B)
  4. C) mitosis followed by meiosis.
  5. D) meiosis followed by mitosis.
  6. E) None of the other answer options is correct.

 

 

  1. In a diploid individual, one chromosome carries A and B genes, and the homologous chromosome carries different forms (alleles) of these same genes, a and b. If there is a single crossover between these two genes involving non-sister chromatids during metaphase I of meiosis, the resulting four gametes are:
  2. A) AB, AB, ab, ab.
  3. B) AB, ab, AB, ab.
  4. C) AaBb, AaBb, AaBb, AaBb.
  5. D) AB, Ab, aB, ab.
  6. E) Ab, Ab, aB, aB.

 

 

  1. The two strands in a molecule of DNA are:
  2. A) exact copies of each other.
  3. B)
  4. C)
  5. D) sister chromatids.
  6. E)

 

 

  1. The random alignment of maternal and paternal homologous chromosomes during metaphase I is one of the ways genetic variability among gametes comes about. For example, it is possible for an organism with 4 pairs of homologous chromosomes to produce gametes with up to 16 different combinations of maternal and paternal chromosomes (24 = 16). In the case of humans with 23 pairs of chromosomes, there are over 8 million possible combinations. How many possible combinations of maternal and paternal chromosomes are possible in the gametes of an organism with 8 chromosomes?
  2. A) 16
  3. B) 64
  4. C) 256
  5. D) 512
  6. E) 1024

 

 

  1. The epithelial cells in the skin of an animal have 24 chromosomes. How many chromosomes are present in the gametes of this animal?
  2. A) 6
  3. B) 12
  4. C) 24
  5. D) 48

 

 

  1. Consider a diploid organism with a haploid complement of four chromosomes. At prophase I, how many total chromosomes will be present in a cell?
  2. A) 4, one complete set of chromosomes
  3. B) 8, four pairs of homologous chromosomes
  4. C) 12, four pairs of homologous chromosomes and their haploid complement
  5. D) 16, four pairs of homologous chromosomes and two sister chromatids per chromosome

 

 

  1. The FoxP2 gene is thought to be involved in language in humans. At prophase I, how many copies of the FoxP2 gene are present in a cell? Keep in mind that humans are diploid.
  2. A) two copies, one on each homologous chromosome
  3. B) four copies, one on each sister chromatid in a pair of homologous chromosomes
  4. C) eight copies, one on each sister chromatid in a pair of homologous chromosomes
  5. D) eight copies, one on each strand of each chromatid per homologous pair

 

 

  1. Sister chromatids are separated during:
  2. A)
  3. B) meiosis I and mitosis.
  4. C) meiosis II and mitosis.
  5. D) meiosis I.
  6. E) meiosis II.

 

 

  1. A homologous chromosome pair is best described as two chromosomes that have:
  2. A) the same genes in the same order but possibly with different alleles of some of the genes.
  3. B) the same alleles of the same genes in the same order.
  4. C) the same genes possibly arranged in a different order with potentially different alleles of some of the genes.
  5. D) different alleles of the same genes arranged in a different order.
  6. E) identical sequences of nucleotides.

 

 

  1. During meiosis, genetic variability is introduced during which of the following phases? (Select all that apply.)
  2. A) anaphase II
  3. B) metaphase I
  4. C) prophase I
  5. D) prophase II
  6. E) prometaphase I

 

 

  1. Which of the following describes the result(s) of crossing over that takes place in meiosis I? (Select all that apply.)
  2. A) The formation of a DNA molecule that is part maternal and part paternal.
  3. B) The loss of genetic information from one chromosome and the gain of information by another.
  4. C) Homologous chromosomes trade one of their two sister chromatids.
  5. D) The formation of a chiasma.
  6. E) Homologous chromosomes are held together.
  7. F) The formation of a chromatid that is part maternal and part paternal.

 

 

  1. Which of the following has the MOST similarity in nucleotide sequence?
  2. A) homologous chromosomes
  3. B) nonhomologous chromosomes
  4. C) sister chromatids
  5. D) complementary strands of DNA
  6. E) maternal and paternal copies of the same chromosome

 

 

  1. In meiosis, recombination occurs:
  2. A) during prophase I and II and involves exchange of chromosome fragments between all four chromatids.
  3. B) only during prophase I and involves exchange between chromatids of homologous chromosomes.
  4. C) only during prophase I and involves exchange of chromosome fragments between sister chromatids.
  5. D) during prophase I and II and involves exchange of chromosome fragments between sister chromatids.

 

 

  1. A cell in prophase I of meiosis has _____ as many chromosomes as each of the daughter cells following cytokinesis of meiosis II.
  2. A) twice
  3. B) half
  4. C) one quarter
  5. D) four times

 

 

  1. A cell in prophase I of meiosis has _____ as much DNA as each of the daughter cells following cytokinesis of meiosis II.
  2. A) twice
  3. B) half
  4. C) one quarter
  5. D) four times

 

 

  1. Sexual reproduction results:
  2. A) in offspring that are not genetically identical.
  3. B) from combining genetic material from two gametes.
  4. C) in a new generation that is not genetically identical to its parents.
  5. D) in a new generation with the same number of chromosomes as each parent.
  6. E) All of these choices are correct.

 

 

  1. Meiosis is thought to have appeared early in evolution because most eukaryotes perform meiosis and the steps of meiosis are the same in all eukaryotes.
  2. A) True
  3. B) False

 

 

  1. Which of the following statements is NOT true about gamete formation in mammals?
  2. A) In the female, the separation of cytoplasm is unequal during meiosis.
  3. B) Only one of the four cells resulting from meiosis goes on to become an oocyte.
  4. C) Only one of the four cells resulting from meiosis goes on to become an egg, which becomes a zygote upon fertilization by a sperm cell.
  5. D) The polar bodies formed during meiosis in the female can participate in fertilization with sperm.
  6. E) The cytoplasm is diminished during development of sperm, and a flagellum is formed to give sperm locomotion.

 

 

  1. In fungi and plants, mitotic cell division of haploid cells follows meiosis.
  2. A) True
  3. B) False

 

 

  1. At the end of mitosis the daughter cells are _____, whereas at the end of meiosis the daughter cells are _____.
  2. A) haploid; diploid
  3. B) diploid; haploid
  4. C) diploid; polyploid
  5. D) polyploid; haploid

 

 

  1. Why does meiosis result in more genetic variation than can be explained by mutation alone? (Select all that apply.)
  2. A) because of the events of meiosis I
  3. B) because of the events of meiosis II
  4. C) because of crossing over
  5. D) not all the DNA gets replicated

 

 

  1. Which of the following happens during prophase I of meiosis?
  2. A) recombination between non-sister chromatids of homologous chromosomes
  3. B) recombination between sister chromatids of homologous chromosomes
  4. C) recombination between non-sister chromatids of nonhomologous chromosomes
  5. D) recombination between sister chromatids of nonhomologous chromosomes

 

 

  1. Homologous pairs of chromosomes separate during:
  2. A)
  3. B) meiosis I and mitosis.
  4. C) meiosis II and mitosis.
  5. D) meiosis I.
  6. E) meiosis II.

 

 

  1. During meiosis, two rounds of DNA synthesis are required to form four gametes from one parent cell.
  2. A) True
  3. B) False

 

 

  1. Which of the following is NOT true about gametes?
  2. A) They are formed by meiotic cell division.
  3. B) They have half as many chromosomes as a somatic cell of the same individual.
  4. C) They are called eggs and sperm in animals.
  5. D) They fuse to form a new organism during fertilization.
  6. E) They are genetically identical to other gametes formed during meiosis.

 

 

  1. During meiosis I:
  2. A) bivalents are formed during prophase I and are taken apart during anaphase I.
  3. B) chromosomes undergo reductional division.
  4. C) sister chromatids are not separated.
  5. D) non-sister chromatids exchange maternal and paternal DNA.
  6. E) All of these choices are correct.

 

 

  1. The second meiotic division resembles mitosis because:
  2. A) sister chromatids are separated during anaphase II to become the chromosomes of the daughter cells.
  3. B) spindle microtubules attach from opposite directions to the centromere of each sister chromatid pair.
  4. C) chromosomes decondense during telophase II.
  5. D) the daughter cells have the same number of chromosomes as the parent cell..
  6. E) All of these choices are correct.

 

 

  1. Sexual reproduction results in an increase in genetic diversity because:
  2. A) during prophase I, genes that are paternally and maternally derived recombine so that the gametes have chromosomes that are different from the parents’ chromosomes.
  3. B) during metaphase I, the bivalents line up in a random orientation so that gametes inherit a random set of maternally and paternally derived chromosomes.
  4. C) during fertilization, the gametes that fuse are random so that a large number of chromosomal combinations are possible in the new organism.
  5. D) All of these choices are correct.

 

 

  1. Which of the following is NOT a characteristic of meiotic cell division?
  2. A) Cell division results in the production of gametes.
  3. B) Daughter cells are genetically identical.
  4. C) Cell division results in the formation of four daughter cells.
  5. D) Cell division requires two rounds of nuclear division.

 

 

  1. Crossing over occurs during which step in meiosis?
  2. A) prophase I
  3. B) anaphase I
  4. C) prophase II
  5. D) metaphase I

 

 

  1. Synapsis is best described as the:
  2. A) exchange of genetic information between sister chromatids.
  3. B) alignment of non-sister chromatids at the metaphase plate.
  4. C) exchange of genetic information between non-sister chromatids.
  5. D) pairing of homologous chromosomes in prophase I.

 

 

  1. When do sister chromatids separate in meiosis?
  2. A) anaphase I
  3. B) metaphase II
  4. C) anaphase II
  5. D) telophase I

 

 

  1. The alignment of chromosomes at metaphase of meiosis II is most similar to the alignment of chromosomes during metaphase of mitosis.
  2. A) True
  3. B) False

 

 

  1. A zygote is:
  2. A)
  3. B)
  4. C)
  5. D)

 

 

  1. Another name for non-sister chromatids is:
  2. A)
  3. B)
  4. C)
  5. D) homologous chromosomes.

 

 

  1. During what step in meiosis do the daughter cells become haploid?
  2. A) metaphase II
  3. B) anaphase I
  4. C) anaphase II
  5. D) prophase II

 

 

  1. How does meiosis generate genetic diversity?
  2. A) crossing over
  3. B) random alignment at metaphase I
  4. C) synapsis
  5. D) both crossing over and random alignment at metaphase I

 

 

  1. Polar bodies are:
  2. A) haploid cells.
  3. B) functional gametes that are produced by meiosis.
  4. C) produced by mitosis.
  5. D) functional gametes that are produced by mitosis.

 

 

  1. What cytoskeletal protein is important to the function of the sperm cells illustrated in Figure 11.13?

 

  1. A) microfilaments
  2. B) intermediate filaments
  3. C) microtubules
  4. D) All of these choices are correct.

 

 

  1. What would happen if crossing over occurred between sister chromatids?
  2. A) Genetic diversity would decrease due to the loss of gene combinations.
  3. B) Genetic diversity would increase due to the addition of gene combinations.
  4. C) Gene rearrangement would lead to changes in gene expression.
  5. D) Nothing would happen because sister chromatids are genetically identical or nearly identical.

 

 

  1. How must spindle microtubules attach to chromosomes during prometaphase of meiosis I?
  2. A) Spindle microtubules from one pole must attach to both kinetochores in a pair of sister chromatids.
  3. B) Spindle microtubules from one pole attach to one kinetochore, and spindle microtubules from the other pole attach to the other kinetochore in a pair of sister chromatids, just like in mitosis.
  4. C) Microtubules attach to the chiasma.
  5. D) Microtubules attach using their minus (slow assembling) ends.
  6. E) Microtubules attach at the centrosomes.

 

 

  1. Predict what would happen if crossing over between homologous chromosomes occurred as part of mitosis.
  2. A) Daughter cells would not be genetically identical.
  3. B) Daughter cells could contain two copies of the same allele.
  4. C) There would be no effect because sister chromatids separate in anaphase.
  5. D) Daughter cells would not be genetically identical, and they could contain two copies of the same allele.

 

 

  1. Homologous chromosomes separate from each other in:
  2. A)
  3. B) meiosis I.
  4. C) meiosis II.
  5. D) They never separate from each other during any form of cell division.

 

 

  1. Many of the specific functions that are triggered when a cell passes one of the cell cycle checkpoints result from activation of enzymes and other proteins. A common mechanism for this activation is:
  2. A) phosphorylation of specific proteins.
  3. B) signal transduction.
  4. C) polymerization of tubulin.
  5. D) ATP synthesis.

 

 

  1. Which one of the following is capable of phosphorylating key proteins involved in regulating the cell cycle?
  2. A) cyclin
  3. B) CDK
  4. C) phosphatase
  5. D) p53 protein
  6. E) cyclin-CDK complex

 

 

  1. Which major checkpoint delays the cell cycle when DNA replication is incomplete?
  2. A) G1 checkpoint
  3. B) G2 checkpoint
  4. C) M checkpoint
  5. D) G1, G2, and the M checkpoints
  6. E) None of the checkpoints delays the cell cycle when DNA replication is incomplete.

 

 

  1. CDKs are important in the regulation of the cell cycle. They carry out their function by:
  2. A) adding phosphate groups to target proteins.
  3. B) removing phosphate groups from target proteins.
  4. C) degrading cyclin proteins.
  5. D) preventing the progression of a cell from one stage of the cell cycle to the next.

 

 

  1. Which of the following statements concerning cyclin-dependent kinases (CDKs) is NOT true?
  2. A) CDKs are enzymes that attach phosphate groups to other proteins.
  3. B) CDKs are active, or “turned on,” when complexed with cyclins.
  4. C) CDKs are present throughout the cell cycle.
  5. D) CDKs are inactive, or “turned off,” in the presence of cyclins.

 

 

  1. Processes that regulate cell division in mammals include:
  2. A) production of cyclin proteins that activate CDK enzymes.
  3. B) activated cyclin-CDK complexes triggering cell cycle events.
  4. C) different cyclins and CDKs acting at different stages of the cell cycle to promote cell division.
  5. D) rapid degradation of cyclins after CDK activation.
  6. E) All of these choices are correct.

 

 

  1. Most of the significant changes in activities and functions that accompany passage through a cell cycle checkpoint are regulated by the:
  2. A) activation of microtubules.
  3. B) changes in membrane polarization.
  4. C) activation of kinase enzymes.
  5. D) activation of DNA polymerase.
  6. E) inhibition of cyclin proteins.

 

 

  1. The amount of _____ is fairly constant throughout the cell cycle, but the amount of _____ varies.
  2. A) cyclins/cyclin-dependent kinases
  3. B) DNA/cyclins
  4. C) cyclin-dependent kinase/DNA
  5. D) cyclins/DNA

 

 

  1. Studies of rapidly dividing embryonic animal cells revealed:
  2. A) a cyclic production of certain proteins in sync with the cell cycle.
  3. B) a cyclic activation of protein kinases in sync with the cell cycle.
  4. C) that the production of cyclin proteins is followed by activation of CDK enzymes.
  5. D) that inhibition of protein production blocks mitosis.
  6. E) All of these choices are correct.

 

 

  1. Which of these events does NOT include a checkpoint in the cell cycle?
  2. A) the transition from G1 to S phase
  3. B) the transition from G2 to M phase
  4. C) the beginning of M phase
  5. D) All of these events include a checkpoint in the cell cycle.

 

 

  1. The S cyclin-CDK complex:
  2. A) controls the cell cycle during the S and G2 phases.
  3. B) triggers initiation of DNA synthesis during the S phase.
  4. C) prevents initiation of DNA synthesis a second time during the S and G2 phases.
  5. D) both controls the cell cycle during the S and G2 phases, and triggers initiation of DNA synthesis during the S phase.
  6. E) All of these choices are correct.

 

 

  1. The M cyclin-CDK complex:
  2. A) controls the cell cycle during the M phase.
  3. B) initiates many events of mitosis.
  4. C) triggers phosphorylation of certain nuclear proteins, resulting in breakdown of the nuclear envelope during prophase.
  5. D) phosphorylates proteins that promote formation of the mitotic spindle.
  6. E) All of these choices are correct.

 

 

  1. When nutrients are suboptimal for cell growth and division, the cell cycle arrests. At which stage of the cell cycle/checkpoint would you predict this arrest to occur?
  2. A) G1 checkpoint
  3. B) G2 checkpoint
  4. C) M checkpoint
  5. D) G1, G2, and the M checkpoints
  6. E) It is not possible to answer with the information given.

 

 

  1. Which one of the following would MOST likely contribute to uncontrolled cell proliferation (i.e., cancer)?
  2. A) a mutant CDK that was active in the absence of its cyclin binding partner
  3. B) a mutant cyclin that cannot bind to its normal CDK binding partner
  4. C) a mutant enzyme needed for microtubule synthesis/polymerization
  5. D) a mutant DNA replication mechanism causing extra chromosome copies
  6. E) a mutant kinetochore protein that causes reduced microtubule attachment

 

 

  1. What would happen to a cell if cyclin was always present in the cell? (Select all that apply.)
  2. A) Cell cycle proteins would be always phosphorylated.
  3. B) Cyclin-dependent kinases would be always activated.
  4. C) The cell would divide rapidly.
  5. D) The cell cycle would not stop at checkpoints.

 

 

  1. p53 is an example of a(n):
  2. A)
  3. B) proto-oncogene.
  4. C) tumor suppressor.
  5. D) cyclin-dependent kinase.

 

 

  1. Cell division is regulated by:
  2. A) growth factor signals.
  3. B) signals that indicate that the cell has reached a sufficient size.
  4. C) signals that indicate that DNA has been replicated.
  5. D) signals about the nutritional status of the cell.
  6. E) All of these choices are correct.

 

 

  1. A graduate student is planning an experiment to evaluate the expression of PDGF-related genes in her cell population of interest. As a control, she hopes to confirm the expression of genes that are present in all dividing cells. For her controls, she should evaluate the expression of:
  2. A)
  3. B)
  4. C) G proteins.
  5. D)
  6. E)

 

 

  1. Which one of the following statements regarding the S cyclin-CDK complex is TRUE?
  2. A) It is responsible for the phosphorylation of nuclear proteins.
  3. B) It ensures that DNA is not replicated multiple times.
  4. C) It is responsible for the degradation of nuclear membranes.
  5. D) It is regulated solely by the action of p53.
  6. E) It regulates the expression of histone proteins.

 

 

  1. Which of the following statements regarding the cell cycle is TRUE?
  2. A) It has many major cell cycle checkpoints.
  3. B) It is regulated by cyclins and CDKs.
  4. C) Different levels of cyclins are observed at different cell cycle stages.
  5. D) It can be “paused” by the action of p53.
  6. E) All of these choices are correct.

 

 

  1. A researcher is evaluating the expression of p53 in cells she is culturing in the laboratory. She notices that in a small group of cells, high levels of phosphorylated p53 occur in the nuclei. What can she deduce about these cells?
  2. A) These cells are normal.
  3. B) Within these cells, the cell cycle has been halted at the G2/M transition.
  4. C) These cells likely contain damaged DNA.
  5. D) All of these cells have entered meiosis.
  6. E) All of these cells have entered mitosis.

 

 

  1. What is a cyclin?
  2. A) a protein that activates kinases
  3. B) a protein whose levels change with the cell cycle
  4. C) a kinase
  5. D) a protein that activates kinases and a protein whose levels change with the cell cycle

 

 

  1. Which of the following is NOT true regarding CDKs?
  2. A) The levels of CDK change with the cell cycle.
  3. B) They bind to cyclin.
  4. C) They function as a kinase.
  5. D) They function to control the cell cycle.

 

 

  1. How do CDKs promote cell division?
  2. A) They regulate the activity of cyclin.
  3. B) They cause cyclin levels to increase and decrease.
  4. C) They bind to DNA.
  5. D) They phosphorylate other proteins.
  6. E) They change the ability of microtubules to polymerize.

 

 

  1. How does a cell regulate the progression of the cell cycle?
  2. A) through the expression and synthesis of cyclin proteins
  3. B) through checkpoints
  4. C) through the expression and synthesis of CDKs
  5. D) through destruction of cyclins
  6. E) All of these choices are correct.

 

 

  1. How do new cyclin proteins appear in the cytoplasm?
  2. A) They are recycled.
  3. B) They are made through protein synthesis.
  4. C) They are imported from outside the cell.
  5. D) All of these choices are correct.

 

 

  1. What happens to CDKs in the absence of cyclins?
  2. A) They are inactive.
  3. B) They are degraded.
  4. C) They become phosphorylated.
  5. D) They are inactive and become phosphorylated.

 

 

  1. At which checkpoint would a cell become arrested if a chromosome was not properly aligned in the spindle?
  2. A) at a checkpoint late in G1
  3. B) at a checkpoint late in G2
  4. C) at a checkpoint early in the mitotic phase
  5. D) None of the other answer options is correct.

 

 

  1. The assembly of what cytoskeletal protein is initiated by the M cyclin-CDK complex?
  2. A) microfilaments
  3. B) microtubules
  4. C) intermediate filaments
  5. D) All of these choices are correct.

 

 

  1. What type of protein is being activated by the G1/S cyclin-CDK complex to promote the expression of histone proteins?
  2. A) a synthase
  3. B) a polymerase
  4. C) a helicase
  5. D) a transcription factor

 

 

  1. How would the loss of p53 activity affect a cell?
  2. A) The G1/S checkpoint would not be functional.
  3. B) DNA damage could accumulate.
  4. C) CDK activity would not be appropriately regulated.
  5. D) All of these choices are correct.

 

 

  1. Cell cycle checkpoints:
  2. A) act as a brake on cell division if something is not right.
  3. B) provide opportunities to check if the cell has carried out steps necessary for cell division.
  4. C) can involve the protein p53.
  5. D) All of these choices are correct.

 

 

  1. Many normal genes that have important functions in cells sometimes acquire mutations that cause the products of these genes to have negative effects, including the development of cancer. These genes are called:
  2. A)
  3. B) proto-oncogenes.
  4. C) tumor suppressor genes.
  5. D) viral genes.

 

 

  1. The first oncogene to be discovered:
  2. A) is a gene that contributes to uncontrolled cell division or cancer.
  3. B) was discovered in a Rous sarcoma virus that causes cancer.
  4. C) is a protein kinase that acts to promote cell division.
  5. D) has a less-active normal counterpart called a proto-oncogene.
  6. E) All of these choices are correct.

 

 

  1. Which of the following is NOT a hallmark of malignant cancer?
  2. A) Cell division in the absence of growth signals.
  3. B) Resistance to signals that slow cell division or promote death.
  4. C) Metastasis, which allows invasion of local tissues.
  5. D) Ability to stimulate growth of blood vessels to provide nutrients to the rapidly growing tumor.
  6. E) All of these choices are hallmarks of cancer.

 

 

  1. In a normal cell, tumor suppressors are responsible for: (Select all that apply.)
  2. A) increasing the rate of cell division.
  3. B) allowing the cell to correct replication errors.
  4. C) signaling that highly defective cells be destroyed.
  5. D) signaling that DNA replication is to begin.

 

 

  1. Cancer-causing genes found in some viruses are called:
  2. A)
  3. B) proto-oncogenes.
  4. C) tumor suppressor genes.
  5. D) viral genes.

 

 

  1. Phosphorylated p53 is a protein that accumulates in the nucleus of a cell that has damaged DNA. The p53 gene that encodes this protein is an example of a(n):
  2. A)
  3. B) proto-oncogene.
  4. C) tumor suppressor gene.
  5. D) protein kinase.

 

 

  1. Which of the following statements is TRUE if a cell has a mutation in the p53 gene such that the p53 protein is no longer able to be phosphorylated?
  2. A) The cell would proceed through the cell cycle even in the presence of DNA damage.
  3. B) The cell would arrest, giving time for the DNA damage to be repaired.
  4. C) The amount of cytoplasmic p53 protein would increase in response to DNA damage.
  5. D) The kinase activity in the nucleus would decrease in response to DNA damage.

 

 

  1. An enzyme that catalyzes the addition of a phosphate group from ATP to another molecule is called a:
  2. A)
  3. B)
  4. C)
  5. D)

 

 

  1. Which of the following would be MOST likely to lead to the development of cancer?
  2. A) the activation of a tumor suppressor gene
  3. B) the activation of a proto-oncogene
  4. C) the activation of an oncogene and the inactivation of a tumor suppressor gene
  5. D) the activation of an oncogene and the activation of a tumor suppressor gene

 

 

  1. Malignancies develop stepwise over time because:
  2. A) it takes time for a benign tumor to be able to dissolve through its encapsulation before it can invade neighboring tissues.
  3. B) benign tumor cells divide slowly and in a stepwise pattern.
  4. C) it takes multiple mutations of multiple genes to allow cancer cells to develop.
  5. D) cells keep leaving the benign tumor and are destroyed in lymph nodes.
  6. E) All of these choices are correct.

 

 

  1. Proto-oncogenes:
  2. A) are mutated forms of genes involved in cell division that are hyperactive.
  3. B) can be mutated by cigarette smoke to become triggers for cancer.
  4. C) encode for abnormal growth factors, cell surface receptors, or members of a signal transduction pathway.
  5. D) None of the answer options is correct.

 

 

  1. Tumor suppressors oppose oncogenes by:
  2. A) slowing cell division.
  3. B) repairing mutations.
  4. C) instructing defective cells to die.
  5. D) blocking the action of an oncogene.
  6. E) All of these choices are correct.

 

 

  1. Which of the following statements about viruses is TRUE?
  2. A) Viruses contain multiple genes, and each of these genes is an oncogene.
  3. B) Viruses are a type of prokaryotic cell.
  4. C) Viruses are the root cause of mostif not allcancers.
  5. D) Human cancers have not been associated with viruses.
  6. E) None of the other answer options is correct.

 

 

  1. Which of the following is considered a proto-oncogene?
  2. A) a gene encoding a G-protein
  3. B) a gene encoding a cell-surface receptor
  4. C) a gene encoding a protein kinase
  5. D) a gene encoding a growth factor
  6. E) All of these choices are correct.

 

 

  1. Some types of leukemia are the result of constitutively active (i.e., “always on”) growth factor receptors.
  2. A) True
  3. B) False

 

 

  1. A proto-oncogene is a “normal” gene that, if mutated, can become an oncogene and lead to a cell becoming cancerous.
  2. A) True
  3. B) False

 

 

  1. A woman has her genome sequenced and finds that she carries a mutation in p53. Will she develop cancer?
  2. A) No, mutations in p53 do not contribute to cancer.
  3. B) Yes, she will certainly develop cancer given the role of p53 in the cell cycle.
  4. C) Possiblythis mutation may predispose her to developing certain types of cancer.

 

 

  1. Recall the experiments of Rous and colleagues. If he had found that filtered cancer cell extract could not cause cancer when injected into healthy animals, what could he have deduced?
  2. A) Cancer may be caused by bacteria.
  3. B) An intact cancer cell is necessary to cause cancer.
  4. C) A large protein may cause cancer.
  5. D) All of these choices are correct.

 

  1. Consider the sentence fragments shown in Figure 13.1, below.

 

 

Which of the following would make assembling the sentence more difficult? (Select all that apply.)

  1. A) If each of the words in the sentence were used only once.
  2. B) If some of the words in the sentence were used several times.
  3. C) If the fragments were longer.
  4. D) If the letters were randomly assembled and did not form known words.

 

 

  1. Using current DNA-sequencing technology, it is possible to sequence an entire chromosome (e.g., human chromosome 1, which contains approximately 250 million nucleotides) as one long molecule.
  2. A) True
  3. B) False

 

 

  1. A shotgun sequencing project yields the following sequence for a strand of DNA.

 

5′-GGTTTGGAGTAT-3′

 

Which of the following sequences overlaps with the sequence above?

  1. A) 5-GGTTTTTAGACT-3
  2. B) 5-GTGTTGGAGCTT-3
  3. C) 5-GAGTATCCAAAT-3
  4. D) 5-GGCTTGAGGTTA-3
  5. E) None of the sequences overlaps with the sequence above.

 

 

  1. A shotgun sequencing project yields the following sequence for a strand of DNA.

 

5-ATTAGAGAAAAT-3

 

Which of the following sequences overlaps with the sequence above?

  1. A) 5-GAAAATTTCAGA-3
  2. B) 5-TGTCACATTAGA-3
  3. C) 5-AAGCCTATTTTC-3
  4. D) 5-TCTAATGGGCCA-3
  5. E) All of the sequences overlap with the sequence above.
  6. F) None of the sequences overlaps with the sequence above.

 

 

  1. A shotgun genome sequencing project is designed in which the average length of a sequenced fragment is 100 nucleotides and each nucleotide is to be sequenced an average of 30 times. For the human genome, which is 3 × 109 base pairs long, how many fragments of 100 nucleotides would need to be sequenced?
  2. A) (3 × 109) × 30 × 100 = 9 × 1011
  3. B) (3 × 109) × 30 ÷ 100 = 9 × 108
  4. C) (3 × 109) × 100 ÷ 30 = 1 × 1010
  5. D) (3 × 109) ÷ (30 × 100) = 1 × 106

 

 

  1. A shotgun genome sequencing project is designed in which the average length of a sequenced fragment is 150 nucleotides and each nucleotide is to be sequenced an average of 20 times. For a genome that is 3 × 107 base pairs long, how many fragments of 150 nucleotides would need to be sequenced?
  2. A) (3 × 107) × 20 × 150 = 9 × 1010
  3. B) (3 × 107) × 150 ÷ 20 = 2.25 × 108
  4. C) (3 × 107) ÷ (20 × 150) = 1 × 104
  5. D) (3 × 107) × 20 ÷ 150 = 4 × 106

 

 

  1. A repetitive sequence that is 300 base pairs in length is present in 200 identical copies arranged end to end in one region of the genome. Could you assemble short sequences across this region? Explain.

 

 

  1. Why is a DNA sequence motif consisting of codons uninterrupted by a stop codon often called a “putative” open reading frame instead of just an open reading frame?
  2. A) because it could be due to chance
  3. B) because it could be due to sequencing error
  4. C) because it might not be transcribed
  5. D) because it could be part of an intron
  6. E) All of these choices are correct.

 

 

  1. In using the shotgun approach to genome sequencing, the sequenced fragments originate from:
  2. A) the beginning of a gene.
  3. B) the center of a gene.
  4. C) random sites scattered across the genome.
  5. D) targeted sites scattered across the genome.
  6. E) None of the other answer options is correct.

 

 

  1. Sequences that are conserved (i.e., similar in many different organisms) are unlikely to be functionally important.
  2. A) True
  3. B) False

 

 

  1. Genome sequencing includes the following steps:
  2. putting the sequences in the correct order
  3. matching regions of overlap
  4. breaking the DNA into small fragments
  5. reconstructing the long sequence of nucleotides
  6. sequencing the DNA

In what order are these steps carried out?

  1. A) 1-2-3-4-5
  2. B) 5-2-3-1-4
  3. C) 3-5-2-1-4
  4. D) 3-5-2-4-1
  5. E) 5-4-3-2-1

 

 

  1. Assembling complete genomic sequences based on the overlap of sequenced fragments can be difficult because the sequenced fragments: (Select all that apply.)
  2. A) may be relatively short (50–100 nucleotides).
  3. B) may have errors in them.
  4. C) may come from either DNA strand.
  5. D) may overlap but come from different locations in the genome.
  6. E) may actually come from bacteria, viruses, or other contaminants.

 

 

  1. A shotgun sequencing project yields the following sequence for a strand of DNA.

 

5-GGTTTGGAGTAT-3

 

In assembling the genome sequence from the short fragments, you look for other fragments that overlap the sequence above. Which of the following sequences overlaps with the sequence above?

  1. A) 5-GGTTTGGAGTGG-3
  2. B) 5-AATTTGGAGTAT-3
  3. C) 5-TTTGGAGTATGG-3
  4. D) All of the sequences overlap with sequence above.
  5. E) None of the sequences overlaps with the sequence above.

 

 

  1. If a genome is sequenced in such a way that any given nucleotide is present in n sequenced fragments, then if each nucleotide is equally likely to be sequenced, the expected proportion of nucleotides that are not present in any of the fragments is given by e–n, where e is the base of natural logarithms. (The value of e is approximately 2.7182.) What is the probability that a nucleotide is not sequenced if n = 1? If n = 2? If n = 3?

 

 

  1. Figure 13.3 below provides examples of various types of sequences that can be found in a segment of double-stranded DNA. Which one of the following is MOST likely to be protein-coding?

 

 

  1. A) noncoding RNA
  2. B) single-copy gene
  3. C) dispersed repeat
  4. D) tandem repeat
  5. E) simple-sequence repeat

 

 

  1. Approximately what percentage of the human genome actually codes for proteins?
  2. A) 0%
  3. B) 5%
  4. C) 0%
  5. D) 5%
  6. E) 0%

 

 

  1. Sometimes a single-stranded molecule of RNA is able to fold back on itself because the nucleotide sequence on one part of the RNA is complementary to another part. This sequence motif results in a:
  2. A) transcription factor binding site.
  3. B) hairpin-shaped structure.
  4. C) chromosome scaffold.
  5. D) negative supercoil.
  6. E) positive supercoil.

 

 

  1. Which one of the following steps comes FIRST in shotgun sequencing?
  2. A) breaking the DNA into small fragments
  3. B) putting the sequences in the correct order
  4. C) matching regions of overlap
  5. D) sequencing the DNA
  6. E) reconstructing the long sequence of nucleotides

 

 

  1. What could be one way to solve the problem of tandem repeats complicating the alignment of DNA fragments in shotgun sequencing?
  2. A) develop techniques to sequence longer DNA fragments
  3. B) sequence more DNA fragments
  4. C) combine sequencing with chromosome painting
  5. D) sequence both strands of the tandem repeats

 

 

  1. Which of the following objects lacks a genome?
  2. A) nucleus
  3. B) chloroplast
  4. C) mitochondrion
  5. D) virus particle
  6. E) All of these choices have a genome.

 

 

  1. Repeated DNA sequences represent a special challenge in genome sequence assembly. Which of the following would be harder to assemble correctly, assuming the number of copies of the repeat can be determined?
  2. A) sequences containing repeats longer than the DNA fragments to assemble
  3. B) sequences containing repeats shorter than the DNA fragments to assemble

 

 

  1. Which one of the following pairs of people has the exact same genome?
  2. A) father and son
  3. B) mother and daughter
  4. C) identical twins
  5. D) fraternal twins
  6. E) None of the other answer options is correct.

 

 

  1. A baby was born whose biological mother and father each donated a set of chromosomes, and an unrelated woman donated the mitochondria. How many “genomes” did this child inherit? How many “genomes” does the child have?
  2. A) 1; 1
  3. B) 2; 1
  4. C) 5; 2.5
  5. D) 3; 1
  6. E) 3; 3

 

 

  1. Which one of the following represents a consequence of sequencing an organism’s genome? (Select all that apply.)
  2. A) An individual’s “personal genome” can be sequenced and compared to the species standard to determine potential for disease inheritance.
  3. B) Genome sequences can be compared among species to determine evolutionary relationships.
  4. C) A sequenced genome can be annotated and searched for open reading frames.
  5. D) Once an organism’s genome is sequenced, everything is known about that organism’s protein expression and behavior.

 

 

  1. Analysis of similarities and differences in the genomes of different species is referred to as:
  2. A) sequence assembly.
  3. B) genome annotation.
  4. C) comparative genomics.
  5. D) personalized medicine.
  6. E) genome conservation.

 

 

  1. Which one of the following types of sequences can be found in a genome?
  2. A) regulatory elements of protein-coding genes
  3. B) noncoding introns
  4. C) protein-coding exons
  5. D) coding sequence for RNAs
  6. E) All of these choices are correct.

 

 

  1. Which one of the following statements about an open reading frame is TRUE?
  2. A) An open reading frame consists of a long string of codons for amino acids.
  3. B) A long open reading frame may be protein coding.
  4. C) An open reading frame is uninterrupted by a stop codon.
  5. D) All of these choices are correct.

 

 

  1. A possible negative consequence of personalized medicine could be:
  2. A) predicting responses to medications.
  3. B) incorrect predictions of sequence motifs.
  4. C) difficulty obtaining insurance if susceptibility to disease becomes public information.
  5. D) tailoring treatments to an individual.
  6. E) None of the other answer options represents negative consequences of personalized medicine.

 

 

  1. Knowledge of your personal genome: (Select all that apply.)
  2. A) tells you what genetic diseases you will get and when in life they will appear.
  3. B) identifies genetic risk factors for disease.
  4. C) allows you to make informed decisions about health.
  5. D) tells you which risky lifestyle choices are OK for you.

 

 

  1. Which of the following statements is TRUE regarding a genome?
  2. A) Genomes always contain DNA.
  3. B) Genomes are composed of chromosomes.
  4. C) Genomes are “heritable,” or passed from parents to offspring.
  5. D) Only prokaryotic and eukaryotic organisms possess genomes.
  6. E) All of these choices are correct.

 

 

  1. “Shotgun” sequencing involves aligning many small sequences from a genome based on sequence similarities.
  2. A) True
  3. B) False

 

 

  1. All of the genetic material transferred from a parent to an offspring is known as a:
  2. A)
  3. B)
  4. C) open reading frame.
  5. D)
  6. E)

 

 

  1. In the eukaryotic DNA sequence below, each highlighted sequence consists of a simple-sequence repeat. How are the underlined regions organized relative to one another?

 

ATTATCATCATCATCATCATTTACTAATCCTCATCATCATCATCATGGAATCTACATCATCATCATCAT

  1. A) as tandem repeats
  2. B) as dispersed repeats
  3. C) as inverted repeats
  4. D) as long terminal repeats
  5. E) as short terminal repeats

 

 

  1. Except for twins and other multiple births, the genome sequence is different in every individual.
  2. A) True
  3. B) False

 

 

  1. An individual’s genome sequence can reveal his or her disease susceptibilities and drug sensitivities, which allows treatments to be tailored to the individual. This approach is called:
  2. A) personalized medicine.
  3. B) sequence assembly.
  4. C) shotgun sequencing.
  5. D) genome annotation.
  6. E) None of the answer options is correct.

 

 

  1. The human chromosome 1 is approximately 250 million nucleotides long. In order to sequence human chromosome 1, the chromosome is broken up into hundreds of small fragments.  These short fragments are placed together in the correct order to generate the long, continuous sequence of nucleotides in chromosome 1.  Placing these fragments together is referred to as sequence:
  2. A)
  3. B)
  4. C)
  5. D)
  6. E)

 

 

  1. What was the goal of the Human Genome Project?
  2. A) identifying every gene in the human sex cell
  3. B) identifying every gene in the human somatic cell
  4. C) sequencing every protein in the human sex cell
  5. D) identifying every protein in the human somatic cell
  6. E) sequencing every gene in the human cell

 

 

  1. Knowing an individual’s DNA sequence may be beneficial because it makes it possible to predict:
  2. A) susceptibility to disease.
  3. B) response to medications.
  4. C) physical differences.
  5. D) the occurrence of a disease.
  6. E) All of these choices are correct.

 

 

  1. Sequence assembly is accomplished by aligning the fragments:
  2. A) in the laboratory by running them through gel electrophoresis.
  3. B) on paper.
  4. C) by using a complex computer program.
  5. D) by joining histones.
  6. E) None of the other answer options is correct.

 

 

  1. Repeated sequences make genome sequencing challenging for of all of the following reasons EXCEPT:
  2. A) repeated sequences are typically longer than the short sequences obtained by automated sequencing.
  3. B) there is no easy way to determine how many copies of the same repeat are present within one chromosome.
  4. C) short repeats may fold back upon themselves to form a double-stranded structure that is not easily sequenced.
  5. D) the long repeats often have mutations that are not easily sequenced.
  6. E) All of these choices are correct.

 

 

  1. Repeated sequences within eukaryotic genomes may be represented as long repeated sequences next to each other, and are called _____ repeats. Repeated sequences in eukaryotic genomes can also be spread throughout the genome, and are called _____ repeats.
  2. A) tandem; dispersed
  3. B) dispersed; tandem
  4. C) overlapping; adjacent
  5. D) adjacent; overlapping
  6. E) None of the other answer options is correct.

 

 

  1. In the eukaryotic DNA sequence below, which type of repeat is underlined?

 

ATTATTTACTAATCCTCATCATCATCATCATGGAATTCATAATGCTAATGG

  1. A) tandem repeat
  2. B) dispersed repeat
  3. C) simple sequence repeat
  4. D) long terminal repeat
  5. E) short terminal repeat

 

 

  1. The eukaryotic DNA sequence below is a tandem repeat. It is also what other kind of repeat?

 

CACACACACACACACACACACACACACACACACACACA

  1. A) transposon repeat
  2. B) dispersed repeat
  3. C) simple sequence repeat
  4. D) long terminal repeat
  5. E) short terminal repeat

 

 

  1. Whole genome sequencing is often approached by a shotgun sequencing technique in which large genomes are:
  2. A) randomly digested, short fragments are sequenced, and the overlapping sequences are assembled in order.
  3. B) digested in a few specific spots, large fragments are sequenced, and the overlapping sequences are assembled in order.
  4. C) randomly digested, short fragments are sequenced, and the overlapping sequences are assembled from largest to smallest.
  5. D) randomly digested, short fragments are sequenced, and the overlapping sequences are assembled from smallest to largest.
  6. E) All of these choices are correct.

 

 

  1. Which one of the following is a feature of DNA that could allow you to distinguish between a DNA sequence that is protein coding and a DNA sequence that is not?
  2. A) Protein-coding DNA sequences contain U (Uracil), and nontranscribed sequences contain T (Thymine).
  3. B) Protein-coding regions frequently contain long open reading frames; others rarely do.
  4. C) Protein-coding sequences are sets of amino acids; others are sets of nucleotides.
  5. D) Protein-coding sequences are single stranded; others sequences are double stranded.
  6. E) All of these choices are correct.

 

 

  1. If you want to identify protein-coding sequences, why is it more efficient to study messenger RNAs than DNA?
  2. A) Because mRNAs have poly-A tails
  3. B) Because mRNAs do not contain the promoter sequence
  4. C) Because triplets of nucleotides in DNA do not indicate what amino acids will be present in a protein.
  5. D) Because processed mRNA does not contain introns.

 

 

  1. Which of the following would be found in DNA sequences but not in mRNA sequences?
  2. A) transcription start sites
  3. B) translation start sites
  4. C) open reading frames
  5. D) exons
  6. E) All of these choices are correct.

 

 

  1. In addition to noncoding sequences, most eukaryotic genomes contain not only functional genes that encode proteins, but also nonfunctional pseudogenes. Pseudogenes are copies of functional genes, but contain mutations that prevent function or could block either transcription or translation. Which of the following could indicate that a gene-like DNA sequence is a pseudogene sequence and not a functioning gene? (Select all that apply.)
  2. A) The sequence has no transcription-factor binding sites.
  3. B) The sequence has no putative open reading frame.
  4. C) The sequence is not transcribed.
  5. D) The sequence has introns and spliceosome-binding sites.
  6. E) The sequence folds back on itself to form a hairpin.

 

 

  1. Which one of the following statements about transposable elements is CORRECT?
  2. A) They replicate themselves and insert themselves into new positions.
  3. B) They are sometimes described as selfish and called the ultimate parasite.
  4. C) They make up 45% of the DNA in the human genome.
  5. D) They can transpose via DNA replication or an RNA intermediate.
  6. E) All of these choices are correct.

 

 

  1. In a genome in which the mean distance between occurrences of a certain sequence motif is 1024 base pairs, about half of the distances between occurrences are smaller than 700 base pairs. How is it possible that more than half of the observations are smaller than the mean?

 

 

  1. A certain sequence motif consists of 5 nucleotide pairs. In a random sequence of double-stranded DNA in which each nucleotide is equally likely to have any of the four bases, what is the probability that any group of 5 adjacent nucleotides has the same sequence as the sequence motif?
  2. A) (1/5)2 = 1/25
  3. B) (1/5)4 = 1/625
  4. C) (1/2)5 = 1/32
  5. D) (1/4)5 = 1/1024
  6. E) None of the answer options is correct.

 

 

  1. Sequences of genomic DNA, and its corresponding messenger RNA (mRNA), are often compared to obtain valuable information for genome annotation. Why is this comparison useful?
  2. A) The open reading frame of the mRNA includes the introns of the genomic DNA.
  3. B) The exclusion of introns in mRNA reveals the intron-exon structure of many protein coding genes.
  4. C) The genomic DNA is longer because the exons are spliced together.
  5. D) The genomic DNA is shorter because the exons are spliced together.
  6. E) The sequences of genomic DNA and mRNA are identical, which serves as independent validation.

 

 

  1. According to the phylogenetic tree showing evolutionary relationships among viruses in Figure 13.6 below, which one of the following is MOST closely related to the human lentivirus HIV2?

 

 

  1. A) a horse lentivirus
  2. B) human lentivirus HIV1
  3. C) a cow lentivirus
  4. D) a simian lentivirus
  5. E) a cat lentivirus

 

 

  1. Which of the following statements are TRUE of the reference human genome sequence that was announced in the year 2000? (Select all that apply.)
  2. A) It represents what the genome of a perfectly healthy person would be.
  3. B) It does not really exist in any human being.
  4. C) It corresponds to the genome sequence of the common ancestor of all humans.
  5. D) includes no mutant genes.
  6. E) It is accessible online as public information.

 

 

  1. Which one of the following BEST describes why genome sequencing can be complicated by repeated sequences?
  2. A) The repeated sequences are often longer than the sequences obtained by automated sequencing.
  3. B) Automated sequencing devices interpret repeated sequences as a single-copy sequence.
  4. C) Repeated sequences artificially inflate the genome size, leading to an exaggerated interpretation of the complexity of the organism.
  5. D) The repeated sequences are too small to gather usable sequence information from.
  6. E) All of these choices are correct.

 

 

  1. Which of the following represent repeated sequences commonly found in the human genome?
  2. A) long sequences repeated in tandem
  3. B) long sequences dispersed throughout the genome
  4. C) short sequences repeated many times in tandem
  5. D) sequences whose transcript can fold back to form a hairpin
  6. E) All of these choices are correct.

 

 

  1. In a random sequence of double-stranded DNA, the probability that there are exactly n nucleotide pairs between two successive occurrences of a short sequence motif is given by (1 – x)nx, where x is the probability of occurrence of the motif along the sequence. When x = 1/512, the mean distance between occurrences is 512 nucleotide pairs. What is the probability that the distance between two occurrences is exactly equal to this mean?

 

 

  1. In a random sequence of double-stranded DNA, the probability that there are n or fewer nucleotide pairs between two successive occurrences of a short sequence motif is given by 1 – (1 – x)n, where x is the probability of occurrence of the motif along the sequence. When x = 1/512, the mean distance between occurrences is 512 nucleotide pairs. What is the probability that the distance between two occurrences is smaller than the mean?

 

 

  1. In the problem above, what is the value of n for which half the distances between occurrences are < n and half are > n?

 

 

  1. In a random sequence of double-stranded DNA with equal nucleotide frequencies, what is the average number of nucleotide pairs between two occurrences of a sequence motif consisting of four nucleotides?
  2. A) 16
  3. B) 32
  4. C) 64
  5. D) 128
  6. E) 256

 

 

  1. Consider a stretch of DNA with two short sequence motifs separated by an unknown number of base pairs. Each position in the intervening DNA is equally likely to be any of the four nucleotides. Would you expect many sites to be close together and a few farther apart? Few to be close together and many farther apart? Equal spacing? A normal distribution of distances between sites? In other words, which of the following curves do you think BEST approximates the distribution of the number of nucleotide pairs between two occurrences of a short sequence motif?

 

 

  1. A) Curve M
  2. B) Curve H
  3. C) Curve K
  4. D) Curve L

 

 

  1. When an open reading frame (ORF) is identified, it may not actually correspond to the amino acid sequence of any polypeptide in the cell. Why not? (Select all that apply.)
  2. A) The DNA may not be transcribed into RNA.
  3. B) It may contain one or more stop codons in the middle.
  4. C) The ORF could be due to chance.
  5. D) The amino acid sequence may not match any known sequence.

 

 

  1. How can researchers distinguish exons from introns in a segment of DNA?
  2. A) Only exons contain three-base sequences that can code for amino acids.
  3. B) Primers won’t bind to introns.
  4. C) Exons have a characteristic sequence.
  5. D) The sequence of exons complements mRNA molecules in the cell.

 

 

  1. Why does Figure 13.6 (below) suggest that human HIV came from chimpanzees at least twice?

 

  1. A) Because not all human HIVs are clustered together in the tree.
  2. B) Because they are both more evolved than cat viruses.
  3. C) Because they all share one common ancestor.
  4. D) Because horse viruses are more distantly related.

 

 

  1. Imagine a genomic researcher who is analyzing the genome of different types of cats. She finds that a particular sequence in the North American Bobcat genome is exactly identical to a sequence found in the common house cat, while most other sequences in those two genomes differ at many nucleotides.  (The most recent common ancestor between bobcats and house cats is estimated to be about 6.8 million years, plenty of time for mutation to generate DNA sequence variation.)

 

Which of the following could explain the identical sequence in these otherwise differing genomes? (Select all that apply.)

  1. A) The sequence encodes a gene that is critical for life and cannot be easily mutated while retaining function.
  2. B) The sequence is contained in a retrovirus that has infected both species.
  3. C) The sequence encodes a protein critical for the production of fur color.
  4. D) The sequence is from an intron of a gene that encodes a muscle protein.

 

 

  1. Genomic pattern recognition begins with identification of sequence _____, which are telltale signs that identify the type of sequence it is.

 

 

  1. Which one of following statements explains why genome annotation is an ongoing, dynamic process in need of continued updating?
  2. A) Our understanding of genes and gene function changes.
  3. B) The functions and interactions of macromolecules are never the same.
  4. C) Sequences change daily because mutation rates are extremely high.
  5. D) Certain structures like hairpins are not predictable using older annotation techniques.
  6. E) All of these choices are correct.

 

 

  1. Imagine that a researcher is comparing the sequence of several protein-coding genes among mice, rabbits, and humans. She finds that, for most of these genes, the rabbit sequences are more similar to the human sequences than are the mouse sequences.  What can she deduce?
  2. A) Mice and rabbits do not share a common ancestor.
  3. B) Mice and humans share a more “recent” common ancestor than do rabbits and humans.
  4. C) No similar proteins exist in mice and humans.
  5. D) More sequences are conserved between rabbits and humans than between humans and mice.
  6. E) Humans and mice do not share a common ancestor.

 

 

  1. Which of the following statements is TRUE regarding sequence motifs?
  2. A) Sequence motifs are found in DNA but not in RNA.
  3. B) Sequence motifs in DNA are found only upstream of protein-coding regions.
  4. C) An open reading frame is a type of sequence motif.
  5. D) Sequence motifs in RNA provide no information about sequence motifs in DNA.
  6. E) None of the answer options is correct.

 

 

  1. A researcher annotating the rabbit genome would describe which of the following?
  2. A) noncoding DNA
  3. B) tandem or dispersed repeats
  4. C) intron/exon boundaries in genes
  5. D) DNA encoding hairpin RNAs
  6. E) All of these choices are correct.

 

 

  1. When a genome is annotated, researchers identify all of the protein-coding genes and assign each protein with a function.
  2. A) True
  3. B) False

 

 

  1. The genome of a virus can contain which of the following?
  2. A) genes that code for surface proteins
  3. B) genes that code for components of the capsid
  4. C) genes that code for reverse transcriptase
  5. D) genes that code for proteases
  6. E) All of these choices are correct.

 

 

  1. A small infectious agent that contains a nucleic acid genome packaged inside a protein coat is called a(n):
  2. A)
  3. B)
  4. C)
  5. D)

 

 

  1. The MOST likely origin of human HIV1 virus is a related virus that infects:
  2. A)
  3. B)
  4. C)
  5. D)
  6. E)

 

 

  1. The reverse transcriptase in the HIV genome encodes a protein that:
  2. A) makes RNA from protein.
  3. B) makes RNA from DNA.
  4. C) makes protein from DNA.
  5. D) makes tRNA from RNA.
  6. E) makes DNA from RNA.

 

 

  1. Comparative _____ is the analysis of the similarities and differences in protein-coding genes and other types of sequences in the genomes of different species.
  2. A) genomics
  3. B) evolution
  4. C) speciation
  5. D) annotation
  6. E) proteomics

 

 

  1. In HIV, RNA is transcribed to DNA by:
  2. A) the matrix.
  3. B) reverse transcriptase.
  4. C) surface glycoprotein.
  5. D) the capsid.
  6. E)

 

 

  1. All DNA sequences are transcribed into RNA.
  2. A) True
  3. B) False

 

 

  1. _____ is the process by which researchers identify various types of sequences.
  2. A) Genome annotation
  3. B) The C-value paradox
  4. C) Karyotype synthesis
  5. D) Chromosome condensation
  6. E) Comparative genomics

 

 

  1. The coding region of mRNA is called an _____, whereas the noncoding region is called a(n) _____.
  2. A) intron; exon
  3. B) exon; intron
  4. C) exon; open reading frame
  5. D) intron; sequence motif
  6. E) intron; transposable element

 

 

  1. Which of the following is NOT a type of sequence identified by gene annotation?
  2. A) topoisomerase
  3. B) noncoding RNA
  4. C) single copy gene
  5. D) tandem repeat
  6. E) simple sequence repeat

 

 

  1. Which of the following are sequence motifs?
  2. A) open reading frame
  3. B) hairpin structures
  4. C) promoters
  5. D) coding region
  6. E) All of these choices are correct.

 

 

  1. The region of DNA sequences before the start of a gene is often called the promoter. One type of promoter is called the TATA box. Many species’ promoters are TATA boxes or a variation of the TATA box.  DNA sequences that are similar in different organisms are called _____ sequences.
  2. A) convergent
  3. B) adjoined
  4. C) conjugate
  5. D) conserved
  6. E) transposable

 

 

  1. Which of the following contribute to the C-value paradox illustrated in Figure 13.8 below? (Select all that apply.)

 

  1. A) Some genomes contain 2, 4, 8, 16, or even more complete sets of chromosomes.
  2. B) Genomes differ in the amount of coding and noncoding DNA they contain.
  3. C) DNA replication is faster in some organisms than in others.
  4. D) Some genomes contain many more transposable elements than others.
  5. E) Some genomes contain more repetitive DNA than others.

 

 

  1. Which of the following statements applies to transposable elements?
  2. A) Some can replicate and insert themselves into another place in the genome.
  3. B) Their copy number can increase from one generation to the next.
  4. C) They account for a significant fraction of the human genome.
  5. D) Some kinds can transpose via an RNA intermediate.
  6. E) All of these choices are correct.

 

 

  1. A polyploid plant is identified that has phenotypes similar to two different diploid plants species found nearby. Which of the following would support the idea that the polyploid plant is a hybrid of the two diploid species?
  2. A) The number of chromosomes in cells of the polyploid plant is the sum of the number of chromosomes in cells of the two diploid plants.
  3. B) The polyploid plant has some sequences much more homologous to sequences in one related diploid plant than the other.
  4. C) The polyploid plant is physically larger than either diploid plant.
  5. D) All of these choices are correct.

 

 

  1. A diploid plant species has 16 chromosomes. How many chromosomes are in a tetraploid “version” of this plant? In the hexaploid? In the octoploid? (Hint: “Tetra” refers to four, “hexa” to six, and “octo” to eight.)
  2. A) 16, 24, and 32
  3. B) 12, 18, and 24
  4. C) 32, 48, and 56
  5. D) 32, 48, and 64

 

 

  1. A diploid species of plant with 22 chromosomes has a tetraploid relative with 44. How many chromosomes are present in the reproductive cells of each species?
  2. A) diploid 11, tetraploid 11
  3. B) diploid 22, tetraploid 22
  4. C) diploid 11, tetraploid 22
  5. D) diploid 22, tetraploid 11

 

 

  1. The C-value paradox applies to:
  2. A)
  3. B)
  4. C)
  5. D)
  6. E) All of these choices are correct.

 

 

  1. Two viruses with genomes of double-stranded DNA are compared and one has a genome size two times as big as the other. This is likely because the one with the larger genome:
  2. A) has more genes.
  3. B) has more repetitive DNA.
  4. C) has more transposable elements.
  5. D) is polyploid.

 

 

  1. A retrotransposon known as Alu1 is about 300 base pairs in length and is present in the human genome in about 1 million copies. Approximately what percentage of the human genome is accounted for by this transposon?
  2. A) 03%
  3. B) 1%
  4. C) 1%
  5. D) 10%
  6. E) 30%

 

 

  1. Among human embryos that are unable to complete development, some have three complete copies of the nuclear genome and others have four complete copies of the nuclear genome. How many chromosomes do cells of these embryos possess, respectively?
  2. A) 23 and 46
  3. B) 46 and 69
  4. C) 69 and 92
  5. D) 92 and 115
  6. E) None of the answer options is correct.

 

 

  1. The vast majority of naturally occurring polyploids have an even number of sets of chromosomes.
  2. A) True
  3. B) False

 

 

  1. Polyploids with an odd number of sets of chromosomes have many problems in meiosis but none in mitosis. Why?
  2. A) DNA replication is less accurate in meiosis than in mitosis.
  3. B) Homologous chromosomes pair in meiosis.
  4. C) Crossing over occurs in meiosis.
  5. D) Chromosomes align on the spindle in meiosis.

 

 

  1. Some common domesticated fruit plants, including seedless watermelon and banana, are triploids. The seeds are small because most are genetically abnormal and do not undergo complete development. Why are most of the seeds genetically abnormal? (Hint: In normal meiosis, the chromosomes form pairs.)
  2. A) Their DNA replication is disrupted.
  3. B) They have broken chromosomes because of crossing over.
  4. C) They have extra and/or missing chromosomes.
  5. D) They have excessive numbers of mitochondria.

 

 

  1. Artificial chromosome doubling can be induced by means of chemicals that prevent the spindle from forming or functioning normally. A certain species of grass has seven pairs of chromosomes. How many chromosomes are present after one round of artificial chromosome doubling? After two rounds of chromosome doubling?
  2. A) 14; 21
  3. B) 14; 28
  4. C) 21; 28
  5. D) 28; 42
  6. E) 28; 56

 

 

  1. Complex organisms can be characterized as having a:
  2. A) small genome with few protein-coding genes.
  3. B) small genome with many protein-coding genes.
  4. C) large genome with few protein-coding genes.
  5. D) large genome with many protein-coding genes.
  6. E) None of the other answer options is correct.

 

 

  1. The estimated number of genes in the human genome is:
  2. A) 15,000.
  3. B) 25,000.
  4. C) 40,000.
  5. D) 250,000.
  6. E) 400,000.

 

 

  1. The marbled lungfish has a genome size almost 50 times larger than that of the human genome. The MOST likely explanation is that the lungfish:
  2. A) has much bigger cells and so needs more DNA.
  3. B) genome is most likely polyploid.
  4. C) genome has a lot more genes.
  5. D) genome contains a lot of repetitive DNA.

 

 

  1. Various species of the flowering plant Chrysanthemum have 18, 36, 54, 72, and 90 chromosomes. The variation is likely due to:
  2. A) repetitive DNA.
  3. B) transposable elements.
  4. C) chromosome fission.
  5. D)
  6. E)

 

 

  1. The C-value paradox states that genome size:
  2. A) is negatively correlated with complexity.
  3. B) is positively correlated with complexity.
  4. C) is uncorrelated with complexity.
  5. D) differs in reproductive cells and nonreproductive cells.

 

 

  1. A retrotranspon known as LINE1 is about 1000 base pairs in length and is present in the human genome in about 516,000 copies. Approximately what percentage of the human genome is accounted for by this transposon?
  2. A) 0017%
  3. B) 017%
  4. C) 17%
  5. D) 7%
  6. E) 17%

 

 

  1. According to Figure 13.8 below, which one of the following accurately lists the taxonomic groups in order of INCREASING genome size (i.e., from smallest to largest)?

 

 

  1. A) salamanders, mammals, teleosts, bacteria
  2. B) teleosts, bacteria, salamanders, mammals
  3. C) bacteria, teleosts, salamanders, mammals
  4. D) bacteria, teleosts, mammals, salamanders
  5. E) None of the other answer options is correct.

 

 

  1. Protozoa make up the taxonomic group with the broadest range of genome sizes, including the smallest and largest genome, among all eukaryotes. Consult Figure 13.8.

 

  1. A) True
  2. B) False

 

 

  1. Polypoidy, which is widespread among plants, can arise from which of the following processes? (Select all that apply.)
  2. A) duplication of a complete set of chromosomes in a single species
  3. B) hybridization between related species followed by duplication
  4. C) deletion of long stretches of noncoding DNA over time
  5. D) introduction of DNA from one species into another via insects and birds
  6. E) expansion of regions of highly repetitive DNA

 

 

  1. Can it be determined from the data in Table 13.1 which eukaryotic species has the largest genome? Can it be determined which species has the greatest number of chromosomes?

 

 

  1. A) yes, yes
  2. B) yes, no
  3. C) no, yes
  4. D) no, no

 

 

  1. Which of the following properties of transposable elements allows them to contribute to the C-value paradox?
  2. A) Their copy number can increase from one generation to the next.
  3. B) Copies of transposable elements can appear on multiple chromosomes.
  4. C) Their replication is controlled by genes found on the transposable element itself.
  5. D) All of these choices are correct.

 

 

  1. The complexity of an organism is proportional to the number of genes in its genome.
  2. A) True
  3. B) False

 

 

  1. What accounts for the diversity of cell types and functions in humans relative to simpler animals, despite not having significantly more genes than simpler animals? (Select all that apply.)
  2. A) Complexity arises from different combinations of proteins.
  3. B) Complexity arises from differential gene expression.
  4. C) Humans gain more genes through horizontal gene transfer.
  5. D) Many human genes can encode multiple proteins.

 

 

  1. Which of the following contributes to the apparent contradiction that the size of an organism’s genome is NOT directly related to the complexity of the organism? (Select all that apply.)
  2. A) having more than two copies of each chromosome
  3. B) a change in the amount of highly repetitive DNA sequences
  4. C) a change in the amount of moderately repetitive DNA sequences
  5. D) varying susceptibility to viral infection

 

 

  1. Having more than two sets of chromosomes in the genome is referred to as:
  2. A) chromosome condensation.
  3. B) repeated sequence motif.
  4. C) the C-value paradox.
  5. D)
  6. E)

 

 

  1. Approximately how much of the human genome codes for protein?
  2. A) 5%
  3. B) 5%
  4. C) 5%
  5. D) 5%
  6. E) None of the answer options is correct.

 

 

  1. There is no correlation between genome size and complexity of an organism.
  2. A) True
  3. B) False

 

 

  1. The size of a genome is measured by:
  2. A) the number of base pairs.
  3. B) gene size.
  4. C) the number of chromosomes.
  5. D) the size of organism.
  6. E) All of these choices are correct.

 

 

  1. Two major types of transposable elements are those that transpose via a DNA intermediate and those that transpose via an RNA intermediate.
  2. A) True
  3. B) False

 

 

  1. Many agricultural crops, like wheat, are:
  2. A)
  3. B)
  4. C)
  5. D)
  6. E)

 

 

  1. Transposable elements make up about 75% of the DNA in the human genome.
  2. A) True
  3. B) False

 

 

  1. It is always true that the larger the organism, the more genes the organism will have in its genome.
  2. A) True
  3. B) False

 

 

  1. Having more than two sets of chromosomes in the genome is called:
  2. A)
  3. B)
  4. C)
  5. D)
  6. E)

 

 

  1. Among flowering plants, 30% to 80% of existing species are polyploidy somewhere within their evolutionary history.
  2. A) True
  3. B) False

 

 

  1. Approximately what percentage of the human genome consists of repetitive DNA or transposable elements?
  2. A) 1%
  3. B) 5%
  4. C) 10%
  5. D) 25%
  6. E) 50%

 

 

  1. In the human genome, retrotransposons vastly outnumber DNA transposons.
  2. A) True
  3. B) False

 

 

  1. Only 2.5% of the human genome actually codes for proteins. The other 97.5% includes:
  2. A) noncoding RNA.
  3. B) repetitive DNA.
  4. C)
  5. D) All of these choices are correct.

 

 

  1. Within the human genome, 45% of the DNA is composed of what?
  2. A) transposable elements
  3. B) highly repetitive DNA
  4. C) moderately repetitive DNA
  5. D) coding sequences
  6. E) noncoding sequences

 

 

  1. In eukaryotes, genome size is a good predictor of gene number and organismal complexity.
  2. A) True
  3. B) False

 

 

  1. The C-value paradox is the disconnect between genome size:
  2. A) and organismal complexity.
  3. B) and gene ratio.
  4. C) within the same species.
  5. D) and gene size.
  6. E) and protein ratio.

 

 

  1. Transposable elements are:
  2. A) proteins that can move outside of the nucleus.
  3. B) proteins that can move into the nucleus.
  4. C) DNA sequences that can insert themselves into RNA.
  5. D) DNA sequences that can insert themselves into new positions within the genome.
  6. E) None of the other answer options is correct.

 

 

  1. Retrotransposons are a class of transposable elements that:
  2. A) replicate and transpose via DNA replication and repair.
  3. B) use RNA as an intermediate.
  4. C) use DNA as an intermediate.
  5. D) use protein as an intermediate.
  6. E) use ribosomes as an intermediate.

 

 

  1. DNA transposable elements are a class of transposable elements that use:
  2. A) tandem repeats as an intermediate.
  3. B) RNA as an intermediate.
  4. C) DNA as an intermediate.
  5. D) protein as an intermediate.
  6. E) ribosomes as an intermediate.

 

 

  1. Chromosome painting (see Figure 13.14) is achieved by labeling various DNA fragments with different fluorescent molecules and hybridizing those to human chromosomes spread on a microscope slide. The result, if done properly, is that each chromosome can be visualized as having a different color.

 

Photo credit: NHGRI, www.genome.gov.

 

Given the ability to paint each chromosome differently, what else must be TRUE?

  1. A) No similar gene sequences are found on more than one chromosome.
  2. B) Each chromosome must have at least some sequences not found on other chromosomes.
  3. C) Transposable element sequences must cluster together on single chromosomes.
  4. D) Each chromosome condenses around histones in its own way.
  5. E) None of the other answer choices is correct.